Endothelin A Receptor (EDNRA) (NM_001256283) Human Untagged Clone

CAT#: SC330390

EDNRA (untagged) - Homo sapiens endothelin receptor type A (EDNRA), transcript variant 3



  "NM_001256283" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-EDNRA Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ET-A; ETA; ETA-R; ETAR; ETRA; hET-AR
Vector pCMV6-Entry
Sequence Data
>SC330390 representing NM_001256283.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTACCCTTTGAATATAGGGGTGAACAGCATAAAACCTGTATGCTCAATGCCACATCAAAATTCATG
GAGTTCTACCAAGATGTAAAGGACTGGTGGCTCTTCGGGTTCTATTTCTGTATGCCCTTGGTGTGCACT
GCGATCTTCTACACCCTCATGACTTGTGAGATGTTGAACAGAAGGAATGGCAGCTTGAGAATTGCCCTC
AGTGAACATCTTAAGCAGCGTCGAGAAGTGGCAAAAACAGTTTTCTGCTTGGTTGTAATTTTTGCTCTT
TGCTGGTTCCCTCTTCATTTAAGCCGTATATTGAAGAAAACTGTGTATAACGAGATGGACAAGAACCGA
TGTGAATTACTTAGTTTCTTACTGCTCATGGATTACATCGGTATTAACTTGGCAACCATGAATTCATGT
ATAAACCCCATAGCTCTGTATTTTGTGAGCAAGAAATTTAAAAATTGTTTCCAGTCATGCCTCTGCTGC
TGCTGTTACCAGTCCAAAAGTCTGATGACCTCGGTCCCCATGAACGGAACAAGCATCCAGTGGAAGAAC
CACGATCAAAACAACCACAACACAGACCGGAGCAGCCATAAGGACAGCATGAACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001256283
Insert Size 609 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256283.1
RefSeq Size 3678 bp
RefSeq ORF 609 bp
Locus ID 1909
UniProt ID P25101
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction, Vascular smooth muscle contraction
MW 23.8 kDa
Gene Summary This gene encodes the receptor for endothelin-1, a peptide that plays a role in potent and long-lasting vasoconstriction. This receptor associates with guanine-nucleotide-binding (G) proteins, and this coupling activates a phosphatidylinositol-calcium second messenger system. Polymorphisms in this gene have been linked to migraine headache resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (3) lacks a portion of the 5' UTR and 5' coding region, and uses a downstream start codon, compared to variant 1. The encoded isoform (c) is shorter at the N-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...