ARD1A (NAA10) (NM_001256120) Human Untagged Clone
CAT#: SC330367
NAA10 (untagged) - Homo sapiens N(alpha)-acetyltransferase 10, NatA catalytic subunit (NAA10), transcript variant 3
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARD1; ARD1A; ARD1P; DXS707; hARD1; MCOPS1; NATD; OGDNS; TE2 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330367 representing NM_001256120.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAACATCCGCAATGCGAGGCCAGAGGACCTAATGAACATGCAGCACTGCAACCTCCTCTGCCTGCCC GAGAACTACCAGATGAAATACTACTTCTACCATGGCCTTTCCTGGCCCCAGCTCTCTTACATTGCTGAG GACGAGAATGGGAAGATTGTGGGGGAAGAGGACCCAGATGATGTGCCCCATGGACATATCACCTCATTG GCTGTGAAGCGTTCCCACCGGCGCCTCGGTCTGGCTCAGAAACTGATGGACCAGGCCTCTCGAGCCATG ATAGAGAACTTCAATGCCAAATATGTCTCCCTGCATGTCAGGAAGAGTAACCGGGCCGCCCTGCACCTC TATTCCAACACCCTCAACTTTCAGATCAGTGAAGTGGAGCCCAAATACTATGCAGATGGGGAGGACGCC TATGCCATGAAGCGGGACCTCACTCAGATGGCCGACGAGCTGAGGCGGCACCTGGAGCTGAAAGAGAAG GGCAGGCACGTGGTGCTGGGTGCCATCGAGAACAAGGTGGAGAGCAAAGGCAATTCACCTCCGAGCTCA GGAGAGGCCTGTCGCGAGGAGAAGGGCCTGGCTGCCGAGGATAGTGGTGGGGACAGCAAGGACCTCAGC GAGGTCAGCGAGACCACAGAGAGCACAGATGTCAAGGACAGCTCAGAGGCCTCCGACTCAGCCTCCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001256120 |
Insert Size | 690 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001256120.1 |
RefSeq Size | 1118 bp |
RefSeq ORF | 690 bp |
Locus ID | 8260 |
Protein Families | Druggable Genome |
Protein Pathways | Glycerophospholipid metabolism, Limonene and pinene degradation, Phenylalanine metabolism, Tyrosine metabolism |
MW | 25.8 kDa |
Gene Summary | N-alpha-acetylation is among the most common post-translational protein modifications in eukaryotic cells. This process involves the transfer of an acetyl group from acetyl-coenzyme A to the alpha-amino group on a nascent polypeptide and is essential for normal cell function. This gene encodes an N-terminal acetyltransferase that functions as the catalytic subunit of the major amino-terminal acetyltransferase A complex. Mutations in this gene are the cause of Ogden syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012] Transcript Variant: This variant (3) uses an alternate in-frame splice site in the central coding region, compared to variant 1. This results in a shorter protein (isoform 3), compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232212 | NAA10 (Myc-DDK tagged) - Homo sapiens N(alpha)-acetyltransferase 10, NatA catalytic subunit (NAA10), transcript variant 3 |
CNY 3990.00 |
|
RG232212 | NAA10 (tGFP-tagged) - Homo sapiens N(alpha)-acetyltransferase 10, NatA catalytic subunit (NAA10), transcript variant 3 |
CNY 4370.00 |