ARD1A (NAA10) (NM_001256119) Human Untagged Clone

CAT#: SC330366

NAA10 (untagged) - Homo sapiens N(alpha)-acetyltransferase 10, NatA catalytic subunit (NAA10), transcript variant 2



  "NM_001256119" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
NAA10 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARD1; ARD1A; ARD1P; DXS707; hARD1; MCOPS1; NATD; OGDNS; TE2
Vector pCMV6-Entry
Sequence Data
>SC330366 representing NM_001256119.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAACATCCGCAATGCGAGGCCAGAGGACCTAATGAACATGCAGCACTGCAACCTCCTCTGCCTGCCC
GAGAACTACCAGATGAAATACTACTTCTACCATGGCCTTTCCTGGCCCCAGCTCTCTTACATTGCTGAG
GACGAGAATGGGAAGATTGTGGGGTATGTCCTGGCCAAAATGGAAGAGGACCCAGATGATGTGCCCCAT
GGACATATCACCTCATTGGCTGTGAAGCGTTCCCACCGGCGCCTCGGTCTGGCTCAGAAACTGATGGAC
CAGGCCTCTCGAGCCATGATAGAGAACTTCAATGCCAAATATGTCTCCCTGCATGTCAGGAAGAGGATC
AGTGAAGTGGAGCCCAAATACTATGCAGATGGGGAGGACGCCTATGCCATGAAGCGGGACCTCACTCAG
ATGGCCGACGAGCTGAGGCGGCACCTGGAGCTGAAAGAGAAGGGCAGGCACGTGGTGCTGGGTGCCATC
GAGAACAAGGTGGAGAGCAAAGGCAATTCACCTCCGAGCTCAGGAGAGGCCTGTCGCGAGGAGAAGGGC
CTGGCTGCCGAGGATAGTGGTGGGGACAGCAAGGACCTCAGCGAGGTCAGCGAGACCACAGAGAGCACA
GATGTCAAGGACAGCTCAGAGGCCTCCGACTCAGCCTCCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001256119
Insert Size 663 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001256119.1
RefSeq Size 1091 bp
RefSeq ORF 663 bp
Locus ID 8260
UniProt ID P41227
Protein Families Druggable Genome
Protein Pathways Glycerophospholipid metabolism, Limonene and pinene degradation, Phenylalanine metabolism, Tyrosine metabolism
MW 24.8 kDa
Gene Summary N-alpha-acetylation is among the most common post-translational protein modifications in eukaryotic cells. This process involves the transfer of an acetyl group from acetyl-coenzyme A to the alpha-amino group on a nascent polypeptide and is essential for normal cell function. This gene encodes an N-terminal acetyltransferase that functions as the catalytic subunit of the major amino-terminal acetyltransferase A complex. Mutations in this gene are the cause of Ogden syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (2) lacks an in-frame exon in the coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...