UQCRB (NM_001254752) Human Untagged Clone
CAT#: SC330328
UQCRB (untagged) - Homo sapiens ubiquinol-cytochrome c reductase binding protein (UQCRB), transcript variant 3
CNY 2950.00
货期*
4周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MC3DN3; QCR7; QP-C; QPC; UQBC; UQBP; UQCR6; UQPC |
Vector | pCMV6-Entry |
Sequence Data |
>SC330328 representing NM_001254752.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGATGGTATTCGAAAATGGTATTACAAT GCTGCAGGATTCAATAAACTGGGGTTAATGCGAGATGATACAATATACGAGGATGAAGATGTAAAAGAA GCCATAAGAAGACTTCCTGAGAACCTTTATAATGACAGGATGTTTCGCATTAAGAGGGCACTGGACCTG AACTTGAAGCATCAGATCTTGCCTAAAGAGCAGTGGACCAAATATGAAGAGGTCTTTGCTGTTCCAGCT CTGCACTCTGCTTCCTACTTAGATGAAAAGATCAGCCCATTGAGTGTCCCTCCAGATCCCAAGAAGAGC TTCTGTGAAGCAAACTCTCACCCCTTGAACTGCATTGAAACTAGGCAAAGGAAAATTTCTACCTTGAAC CGTATCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001254752 |
Insert Size | 423 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001254752.1 |
RefSeq Size | 4976 bp |
RefSeq ORF | 423 bp |
Locus ID | 7381 |
UniProt ID | P14927 |
Protein Pathways | Alzheimer's disease, Cardiac muscle contraction, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
MW | 16.3 kDa |
Gene Summary | This gene encodes a subunit of the ubiquinol-cytochrome c oxidoreductase complex, which consists of one mitochondrial-encoded and 10 nuclear-encoded subunits. The protein encoded by this gene binds ubiquinone and participates in the transfer of electrons when ubiquinone is bound. This protein plays an important role in hypoxia-induced angiogenesis through mitochondrial reactive oxygen species-mediated signaling. Mutations in this gene are associated with mitochondrial complex III deficiency. Alternatively spliced transcript variants have been found for this gene. Related pseudogenes have been identified on chromosomes 1, 5 and X. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (3) contains an additional exon that results in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (3) has a distinct C-terminus and is longer than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
Customer
Reviews
Loading...