SPDEF (NM_001252294) Human Untagged Clone

CAT#: SC330284

SPDEF (untagged) - Homo sapiens SAM pointed domain containing ETS transcription factor (SPDEF), transcript variant 2



  "NM_001252294" in other vectors (2)

CNY 3140.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Anti-SPDEF Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms bA375E1.3; PDEF
Vector pCMV6-Entry
Sequence Data
>SC330284 representing NM_001252294.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGCAGCGCCAGCCCGGGTCTGAGCAGCGTATCCCCCAGCCACCTCCTGCTGCCCCCCGACACGGTG
TCGCGGACAGGCTTGGAGAAGGCGGCAGCGGGGGCAGTGGGTCTCGAGAGACGGGACTGGAGTCCCAGT
CCACCCGCCACGCCCGAGCAGGGCCTGTCCGCCTTCTACCTCTCCTACTTTGACATGCTGTACCCTGAG
GACAGCAGCTGGGCAGCCAAGGCCCCTGGGGCCAGCAGTCGGGAGGAGCCACCTGAGGAGCCTGAGCAG
TGCCCGGTCATTGACAGCCAAGCCCCAGCGGGCAGCCTGGACTTGGTGCCCGGCGGGCTGACCTTGGAG
GAGCACTCGCTGGAGCAGGTGCAGTCCATGGTGGTGGGCGAAGTGCTCAAGGACATCGAGACGGCCTGC
AAGCTGCTCAACATCACCGCAGATCCCATGGACTGGAGCCCCAGCAATGTGCAGAAGTGGCTCCTGTGG
ACAGAGCACCAATACCGGCTGCCCCCCATGGGCAAGGCCTTCCAGGAGCTGGCGGGCAAGGAGCTGTGC
GCCATGTCGGAGGAGCAGTTCCGCCAGCGCTCGCCCCTGGGTGGGGATGTGCTGCACGCCCACCTGGAC
ATCTGGAAGTCAGCCTCGACCAGTGAGGAGAGCTGGACCGACAGCGAGGTGGACTCATCATGCTCCGGG
CAGCCCATCCACCTGTGGCAGTTCCTCAAGGAGTTGCTACTCAAGCCCCACAGCTATGGCCGCTTCATT
AGGTGGCTCAACAAGGAGAAGGGCATCTTCAAAATTGAGGACTCAGCCCAGGTGGCCCGGCTGTGGGGC
ATCCGCAAGAACCGTCCCGCCATGAACTACGACAAGCTGAGCCGCTCCATCCGCCAGTATTACAAGAAG
GGCATCATCCGGAAGCCAGACATCTCCCAGCGCCTCGTCTACCAGTTCGTGCACCCCATCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001252294
Insert Size 960 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001252294.1
RefSeq Size 1866 bp
RefSeq ORF 960 bp
Locus ID 25803
UniProt ID O95238
Protein Families Transcription Factors
MW 35.7 kDa
Gene Summary The protein encoded by this gene belongs to the ETS family of transcription factors. It is highly expressed in the prostate epithelial cells, and functions as an androgen-independent transactivator of prostate-specific antigen (PSA) promoter. Higher expression of this protein has also been reported in brain, breast, lung and ovarian tumors, compared to the corresponding normal tissues, and it shows better tumor-association than other cancer-associated molecules, making it a more suitable target for developing specific cancer therapies. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Transcript Variant: This variant (2) lacks an in-frame coding exon compared to variant 1. This results in a shorter isoform (2) missing an internal protein segment compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...