DSCR1L1 (RCAN2) (NM_001251974) Human Untagged Clone

CAT#: SC330252

RCAN2 (untagged) - Homo sapiens regulator of calcineurin 2 (RCAN2), transcript variant 2



  "NM_001251974" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-RCAN2 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CSP2; DSCR1L1; MCIP2; RCN2; ZAKI-4; ZAKI4
Vector pCMV6-Entry
Sequence Data
>SC330252 representing NM_001251974.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGGGGAGAATCATACTTCATCGGAATGAGGAGCCCAGGGCAGCAGGGACACGTCCCTGAAGATGGA
GGACTTTTCTTACTGTGCTGCATAGACAGGGACTGGGCTGTCACTCGTTGTTTTGCAGAAGAAGCCTTT
CAAGCAATCACTGACTTCAATGACCTCCCCAACTCGTTGTTTGCGTGCAATGTTCACCAGTCAGTGTTT
GAAGGAGAAGAGAGCAAGGAAAAATTTGAGGGACTGTTTCGGACTTATGATGACTGTGTGACGTTCCAG
CTATTTAAGAGTTTCAGACGTGTCCGTATAAACTTCAGCAATCCTAAATCTGCAGCCCGAGCTAGGATA
GAGCTTCATGAAACCCAATTCAGAGGGAAAAAATTAAAGCTCTACTTTGCACAGGTTCAGACTCCAGAG
ACAGATGGAGACAAACTGCACTTGGCTCCACCCCAGCCTGCCAAACAGTTTCTCATCTCGCCCCCTTCC
TCCCCACCTGTTGGCTGGCAGCCCATCAACGATGCCACGCCAGTCCTCAACTATGACCTCCTCTATGCT
GTGGCCAAACTAGGACCAGGAGAGAAGTATGAGCTCCATGCAGGGACTGAGTCCACCCCAAGTGTCGTC
GTGCACGTGTGCGACAGTGACATAGAGGAAGAAGAGGACCCAAAGACTTCCCCAAAGCCAAAAATCATC
CAAACTCGGCGTCCTGGCCTGCCACCCTCCGTGTCCAACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001251974
Insert Size 732 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001251974.1
RefSeq Size 3316 bp
RefSeq ORF 732 bp
Locus ID 10231
UniProt ID Q14206
MW 27.3 kDa
Gene Summary This gene encodes a member of the regulator of calcineurin (RCAN) protein family. These proteins play a role in many physiological processes by binding to the catalytic domain of calcineurin A, inhibiting calcineurin-mediated nuclear translocation of the transcription factor NFATC1. Expression of this gene in skin fibroblasts is upregulated by thyroid hormone, and the encoded protein may also play a role in endothelial cell function and angiogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (2, also known as beta-1) differs in the 5' UTR and uses an alternate start codon, compared to variant 1. Variants 2 and 3 encode the same isoform (2, also known as beta), which is longer and has a distinct N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...