p53 AIP1 (TP53AIP1) (NM_001251964) Human Untagged Clone

CAT#: SC330250

TP53AIP1 (untagged) - Homo sapiens tumor protein p53 regulated apoptosis inducing protein 1 (TP53AIP1), transcript variant 4



  "NM_001251964" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal p53AIP1 Antibody
    • 100 ug

CNY 5808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms P53AIP1
Vector pCMV6-Entry
Sequence Data
>SC330250 representing NM_001251964.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGATCTTCCTCTGAGGCGAGCTTCAGATCTGCTCAAGCTTCCTGCAGTGGGGCCAGGAGGCAGGGC
CTGGGCAGGGGAGACCAGAACCTCTCGGTGATGCCTCCGAATGGCAGGGCTCAGACACACACACCTGGC
TGGGTAAGTCCCTGCAGTGAAAACCGAGACGGTCTTTTGCCTGCCACAGCCCCGGGCAGACTCTGCTCT
CACCGTGGTGCCGACATCCCAAGTTTTCAGACTCACCAGGACCCAGTGACAGCATCTGGGTCCTCAGAG
CTGCATGCGGACTGTCCCCAGTTCAGAGCATTGGACAGAGCTGGGAACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001251964
Insert Size 327 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001251964.1
RefSeq Size 3158 bp
RefSeq ORF 327 bp
Locus ID 63970
UniProt ID Q9HCN2
Protein Families Druggable Genome
Protein Pathways p53 signaling pathway
MW 11.3 kDa
Gene Summary This gene is specifically expressed in the thymus, and encodes a protein that is localized to the mitochondrion. The expression of this gene is inducible by p53, and it is thought to play an important role in mediating p53-dependent apoptosis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (4, also known as gamma) differs at the 3' end compared to variant 1, and encodes a shorter isoform (d) with a distinct C-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...