SPIB (NM_001243999) Human Untagged Clone

CAT#: SC330206

SPIB (untagged) - Homo sapiens Spi-B transcription factor (Spi-1/PU.1 related) (SPIB), transcript variant 3



  "NM_001243999" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-SPIB Antibody
    • 100 ug

CNY 5808.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SPI-B
Vector pCMV6-Entry
Sequence Data
>SC330206 representing NM_001243999.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCTCGCCCTGGAGGCTGCACAGCTCGACGGGCCACACTTCAGCTGTCTGTACCCAGATGGCGTCTTC
TATGACCTGGACAGCTGCAAGCATTCCAGCTACCCTGATTCAGAGGGGGCTCCTGACTCCCTGTGGGAC
TGGACTGTGGCCCCACCTGTCCCAGCCACCCCCTATGAAGCCTTCGACCCGGCAGCAGCCGCTTTTAGC
CACCCCCAGGCTGCCCAGCTCTGCTACGAACCCCCCACCTACAGCCCTGCAGGGAACCTCGAACTGGCC
CCCAGCCTGGAGGCCCCGGGGCCTGGCCTCCCCGCATACCCCACGGAGAACTTCGCTAGCCAGACCCTG
GTTCCCCCGGCATATGCCCCGTACCCCAGCCCTGTGCTATCAGAGGAGGAAGACTTACCGTTGGACAGC
CCTGCCCTGGAGGTCTCGGACAGCGAGTCGGATGAGGCCCTCGTGGCTGGCCCCGAGGGGAAGGGATCC
GAGGGACTCGCAAGAAGCTGCGCCTGTACCAGTTCCTGCTGGGGCTACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001243999
Insert Size 534 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001243999.1
RefSeq Size 3533 bp
RefSeq ORF 534 bp
Locus ID 6689
UniProt ID Q01892
Protein Families Transcription Factors
MW 18.6 kDa
Gene Summary The protein encoded by this gene is a transcriptional activator that binds to the PU-box (5'-GAGGAA-3') and acts as a lymphoid-specific enhancer. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (3, also known as DeltaSpi-B) uses an alternate splice junction at the 3' end of a coding exon compared to variant 1, that causes a frameshift. The resulting isoform (3) has a shorter and distinct C-terminus compared to isoform 1. This isoform is found in the cytoplasm instead of the nucleus. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...