HLA-DQB1 (NM_001243961) Human Untagged Clone
CAT#: SC330201
HLA (untagged) - Homo sapiens major histocompatibility complex, class II, DQ beta 1 (HLA-DQB1), transcript variant 2
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CELIAC1; HLA-DQB; IDDM1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330201 representing NM_001243961.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTCTTGGAAGAAGGCTTTGCGGATCCCCGGAGACCTTCGGGTAGCAACTGTCACCTTGATGCTGGCG ATGCTGAGCTCCCTACTGGCTGAGGGCAGAGACTCTCCCGAGGATTTCGTGTTCCAGTTTAAGGGCATG TGCTACTTCACCAACGGGACGGAGCGCGTGCGTCTTGTGACCAGATACATCTATAACCGAGAGGAGTAC GCGCGCTTCGACAGCGACGTGGGGGTGTACCGCGCGGTGACGCCGCAGGGGCGGCCTGATGCCGAGTAC TGGAACAGCCAGAAGGAAGTCCTGGAGGGGACCCGGGCGGAGTTGGACACGGTGTGCAGACACAACTAC GAGGTGGCGTTCCGCGGGATCTTGCAGAGGAGAGTGGAGCCCACAGTGACCATCTCCCCATCCAGGACA GAGGCCCTCAACCACCACAACCTGCTGGTCTGCTCGGTGACAGATTTCTATCCAGGCCAGATCAAAGTC CGGTGGTTTCGGAATGATCAGGAGGAGACAGCCGGCGTTGTGTCCACCCCCCTTATTAGGAATGGTGAC TGGACTTTCCAGATCCTGGTGATGCTGGAAATGACTCCCCAGCGTGGAGATGTCTACACCTGCCACGTG GAGCACCCCAGCCTCCAGAGCCCCATCACCGTGGAGTGGCGGGCTCAGTCTGAATCTGCCCAGAGCAAG ATGCTGAGTGGCGTTGGAGGCTTCGTGCTGGGGCTGATCTTCCTTGGGCTGGGCCTTATCATCCGTCAA AGGAGTCAGAAAGGACCTCAAGGGCCTCCACCAGCAGGGCTTCTGCACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243961 |
Insert Size | 810 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001243961.1 |
RefSeq Size | 1664 bp |
RefSeq ORF | 810 bp |
Locus ID | 3119 |
Protein Families | Transmembrane |
Protein Pathways | Allograft rejection, Antigen processing and presentation, Asthma, Autoimmune thyroid disease, Cell adhesion molecules (CAMs), Graft-versus-host disease, Systemic lupus erythematosus, Type I diabetes mellitus, Viral myocarditis |
MW | 30.5 kDa |
Gene Summary | HLA-DQB1 belongs to the HLA class II beta chain paralogs. This class II molecule is a heterodimer consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and it contains six exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DQ molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to four different molecules. Typing for these polymorphisms is routinely done for bone marrow transplantation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (2) includes an alternate in-frame exon in the coding region, compared to variant 1. It encodes isoform 2 which is longer than isoform 1. This transcript represents the DQB1*06:02:01:01 allele of the HLA-DQB1 gene, as represented in the assembled chromosome 6 in the primary assembly of the reference genome. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232338 | HLA (Myc-DDK tagged) - Homo sapiens major histocompatibility complex, class II, DQ beta 1 (HLA-DQB1), transcript variant 2 |
CNY 3840.00 |
|
RG232338 | HLA (tGFP-tagged) - Homo sapiens major histocompatibility complex, class II, DQ beta 1 (HLA-DQB1), transcript variant 2 |
CNY 4370.00 |
其它HLA-DQB1产品