CD166 (ALCAM) (NM_001243283) Human Untagged Clone

CAT#: SC330113

ALCAM (untagged) - Homo sapiens activated leukocyte cell adhesion molecule (ALCAM), transcript variant 4



  "NM_001243283" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-ALCAM Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD166; MEMD
Vector pCMV6-Entry
Sequence Data
>SC330113 representing NM_001243283.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAATCCAAGGGGGCCAGTTCCTGCCGTCTGCTCTTCTGCCTCTTGATCTCCGCCACCGTCTTCAGG
CCAGGCCTTGGATGGTATACTGTAAATTCAGCATATGGAGATACCATTATCATACCTTGCCGACTTGAC
GTACCTCAGAATCTCATGTTTGGCAAATGGAAATATGAAAAGCCCGATGGCTCCCCAGTATTTATTGCC
TTCAGATCCTCTACAAAGAAAAGTGTGCAGTACGACGATGTACCAGAATACAAAGACAGATTGAACCTC
TCAGAAAACTACACTTTGTCTATCAGTAATGCAAGGATCAGTGATGAAAAGAGATTTGTGTGCATGCTA
GTAACTGAGGACAACGTGTTTGAGGCACCTACAATAGTCAAGGTGTTCAGTAAGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001243283
Insert Size 402 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001243283.1
RefSeq Size 2075 bp
RefSeq ORF 402 bp
Locus ID 214
UniProt ID Q13740
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
Protein Pathways Cell adhesion molecules (CAMs)
MW 15.1 kDa
Gene Summary This gene encodes activated leukocyte cell adhesion molecule (ALCAM), also known as CD166 (cluster of differentiation 166), which is a member of a subfamily of immunoglobulin receptors with five immunoglobulin-like domains (VVC2C2C2) in the extracellular domain. This protein binds to T-cell differentiation antigene CD6, and is implicated in the processes of cell adhesion and migration. Multiple alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (4) lacks multiple 3' exons, and has an alternate 3' sequence, compared to variant 1. The resulting isoform (4) is the shortest; it is truncated at the C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...