Guanylate kinase (GUK1) (NM_001242839) Human Untagged Clone

CAT#: SC330026

GUK1 (untagged) - Homo sapiens guanylate kinase 1 (GUK1), transcript variant 4



  "NM_001242839" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
GUK1 (Guanylate Kinase 1) mouse monoclonal antibody, clone OTI4A8 (formerly 4A8)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GMK
Vector pCMV6-Entry
Sequence Data
>SC330026 representing NM_001242839.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCGGGCCCCAGGCCTGTGGTGCTGAGCGGGCCTTCGGGAGCTGGGAAGAGCACCCTGCTGAAGAGG
CTGCTCCAGGAGCACAGCGGCATCTTTGGCTTCAGCGTGTCCCATACCACGAGGAACCCGAGGCCCGGC
GAGGAGAACGGCAAAGATTACTACTTTGTAACCAGGGAGGTGATGCAGCGTGACATAGCAGCCGGCGAC
TTCATCGAGCATGCCGAGTTCTCGGGGAACCTGTATGGCACGAGCAAGGTGGCGGTGCAGGCCGTGCAG
GCCATGAACCGCATCTGTGTGCTGGACGTGGACCTGCAGGGTGTGCGGAACATCAAGGCCACCGATCTG
CGGCCCATCTACATCTCTGTGCAGCCGCCTTCACTGCACGTGCTGGAGCAGCGGCTGCGGCAGCGCAAC
ACTGAAACCGAGGAGAGCCTGGTGAAGCGGCTGGCTGCTGCCCAGGCCGACATGGAGAGCAGCAAGGAG
CCCGGCCTGTTTGATGTGGTCATCATTAACGACAGCCTGGACCAGGCCTACGCAGAGCTGAAGGAGGCG
CTCTCTGAGGAAATCAAGAAAGCTCAAAGGACCGGCGCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001242839
Insert Size 594 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001242839.1
RefSeq Size 930 bp
RefSeq ORF 594 bp
Locus ID 2987
UniProt ID Q16774
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Purine metabolism
MW 21.7 kDa
Gene Summary The protein encoded by this gene is an enzyme that catalyzes the transfer of a phosphate group from ATP to guanosine monophosphate (GMP) to form guanosine diphosphate (GDP). The encoded protein is thought to be a good target for cancer chemotherapy. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Transcript Variant: This variant (4) differs in the 5' UTR and coding sequence and contains an alternate coding exon in the 3' end compared to variant 5, that causes a frameshift. The resulting isoform (b) is shorter at the N-terminus and has a shorter and distinct C-terminus compared to isoform c. Variants 2, 3, and 4 all encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...