SIRT5 (NM_001242827) Human Untagged Clone

CAT#: SC330023

SIRT5 (untagged) - Homo sapiens sirtuin 5 (SIRT5), transcript variant 4



  "NM_001242827" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
SIRT5 mouse monoclonal antibody, clone OTI2F1 (formerly 2F1)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SIR2L5
Vector pCMV6-Entry
Sequence Data
>SC330023 representing NM_001242827.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGGAGCAAGGAGCCCAACGCCGGGCACCGCGCCATAGCCGAGTGTGAGACCCGGCTGGGCAAGCAG
GGCCGGCGAGTCGTGGTCATCACCCAGAACATCGATGAGCTGCACCGCAAGGCTGGCACCAAGAACCTT
CTGGAGATCCATGGTAGCTTATTTAAAACTCGATGTACCTCTTGTGGAGTTGTGGCTGAGAATTACAAG
AGTCCAATTTGTCCAGCTTTATCAGGAAAAGGTGCTCCAGAACCTGGAACTCAAGATGCCAGCATCCCA
GTTGAGAAACTTCCCCGGTGTGAAGAGGCAGGCTGCGGGGGCTTGCTGCGACCTCACGTCGTGTGGTTT
GGAGAAAACCTGGATCCTGCCATTCTGGAGGAGGTTGACAGAGAGCTCGCCCACTGTGATTTATGTCTA
GTGGTGGGCACTTCCTCTGTGGTGTACCCAGCAGCCATGTTTGCCCCCCAGGTGGCTGCCAGGGGCGTG
CCAGTGGCTGAATTTAACACGGAGACCACCCCAGCTACGAACAGATTCAGGTTTCATTTCCAGGGACCC
TGTGGAACGACTCTTCCTGAAGCCCTTGCCTGTCATGAAAATGAAACTGTTTCTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001242827
Insert Size 609 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001242827.1
RefSeq Size 4382 bp
RefSeq ORF 609 bp
Locus ID 23408
UniProt ID Q9NXA8
Protein Families Druggable Genome, Transcription Factors
MW 21.7 kDa
Gene Summary This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class III of the sirtuin family. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2010]
Transcript Variant: This variant (4) lacks an exon in the 5' region, resulting in a downstream AUG start codon, compared to variant 1. The encoded isoform (4) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...