SIRT5 (NM_001242827) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	SIR2L5
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC330023 representing NM_001242827. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGGGAGCAAGGAGCCCAACGCCGGGCACCGCGCCATAGCCGAGTGTGAGACCCGGCTGGGCAAGCAG GGCCGGCGAGTCGTGGTCATCACCCAGAACATCGATGAGCTGCACCGCAAGGCTGGCACCAAGAACCTT CTGGAGATCCATGGTAGCTTATTTAAAACTCGATGTACCTCTTGTGGAGTTGTGGCTGAGAATTACAAG AGTCCAATTTGTCCAGCTTTATCAGGAAAAGGTGCTCCAGAACCTGGAACTCAAGATGCCAGCATCCCA GTTGAGAAACTTCCCCGGTGTGAAGAGGCAGGCTGCGGGGGCTTGCTGCGACCTCACGTCGTGTGGTTT GGAGAAAACCTGGATCCTGCCATTCTGGAGGAGGTTGACAGAGAGCTCGCCCACTGTGATTTATGTCTA GTGGTGGGCACTTCCTCTGTGGTGTACCCAGCAGCCATGTTTGCCCCCCAGGTGGCTGCCAGGGGCGTG CCAGTGGCTGAATTTAACACGGAGACCACCCCAGCTACGAACAGATTCAGGTTTCATTTCCAGGGACCC TGTGGAACGACTCTTCCTGAAGCCCTTGCCTGTCATGAAAATGAAACTGTTTCTTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001242827
Insert Size	609 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001242827.1
RefSeq Size	4382 bp
RefSeq ORF	609 bp
Locus ID	23408
UniProt ID	Q9NXA8
Protein Families	Druggable Genome, Transcription Factors
MW	21.7 kDa
Gene Summary	This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class III of the sirtuin family. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2010] Transcript Variant: This variant (4) lacks an exon in the 5' region, resulting in a downstream AUG start codon, compared to variant 1. The encoded isoform (4) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.