DIO2 (NM_001242502) Human Untagged Clone
CAT#: SC329975
DIO2 (untagged) - Homo sapiens deiodinase, iodothyronine, type II (DIO2), transcript variant 4
CNY 2950.00
货期*
4周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 5DII; D2; DIOII; SelY; TXDI2 |
Vector | pCMV6-Entry |
Sequence Data |
>SC329975 representing NM_001242502.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGGCATCCTCAGCGTAGACTTGCTGATCACACTGCAAATTCTGCCAGTTTTTTTCTCCAACTGCCTC TTCCTGGCTCTCTATGACTCGGTCATTCTGCTCAAGCACGTGGTGCTGCTGTTGAGCCGCTCCAAGTCC ACTCGCGGAGAGTGGCGGCGCATGCTGACCTCAGAGGGACTGCGCTGCGTCTGGAAGAGCTTCCTCCTC GATGCCTACAAACAGCTAAATTGTCCTCCATCAGGTTTTAGCAAAGATGGACACATTTTATGACTAGTA TATGAAGCTTATAAAAGCAGACTACTGGTCTACTCACATTTGGATTTATGGATGACTGACAGTGTTGTA CTTACTCTAAATTTCCCAAGGCAAATTAGTCTGTGTTTTGGAAAGAATTCTGCAGCTGAACTATACATT GTTTCTAAGAAGGAGAAGGTGCCTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001242502 |
Insert Size | 441 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001242502.1 |
RefSeq Size | 6284 bp |
RefSeq ORF | 441 bp |
Locus ID | 1734 |
UniProt ID | Q92813 |
Protein Families | Druggable Genome |
MW | 16.7 kDa |
Gene Summary | The protein encoded by this gene belongs to the iodothyronine deiodinase family. It catalyzes the conversion of prohormone thyroxine (3,5,3',5'-tetraiodothyronine, T4) to the bioactive thyroid hormone (3,5,3'-triiodothyronine, T3) by outer ring 5'-deiodination. This gene is widely expressed, including in thyroid and brain. It is thought to be responsible for the 'local' production of T3, and thus important in influencing thyroid hormone action in these tissues. It has also been reported to be highly expressed in thyroids of patients with Graves disease, and in follicular adenomas. The intrathyroidal T4 to T3 conversion by this enzyme may contribute significantly to the relative increase in thyroidal T3 production in these patients. This protein is a selenoprotein containing the non-standard amino acid, selenocysteine (Sec), which is encoded by the UGA codon that normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Unlike the other two members (DIO1 and DIO3) of this enzyme family, the mRNA for this gene contains an additional in-frame UGA codon that has been reported (in human) to function either as a Sec or a stop codon, which can result in two isoforms with one or two Sec residues; however, only the upstream Sec (conserved with the single Sec residue found at the active site in DIO1 and DIO3) was shown to be essential for enzyme activity (PMID:10403186). Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2018] Transcript Variant: This variant (4, also known as hDII-c) includes two novel exons in the coding region, with the latter causing a frameshift compared to variant 1. The resulting isoform (c) is shorter with a distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...