Fbx32 (FBXO32) (NM_001242463) Human Untagged Clone

CAT#: SC329961

FBXO32 (untagged) - Homo sapiens F-box protein 32 (FBXO32), transcript variant 3



  "NM_001242463" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Anti-FBXO32 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Fbx32; MAFbx
Vector pCMV6-Entry
Sequence Data
>SC329961 representing NM_001242463.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCATTCCTCGGGCAGGACTGGCGGTCCCCCGGGCAGAACTGGGTGAAGACGGCCGACGGCTGGAAG
CGCTTCCTGGATGAGAAGAGCGGCAGTTTCGTGAGCGACCTCAGCAGTTACTGCAACAAGGAGGTATAC
AATAAGGAGAATCTTTTCAACAGCCTGAACTATGATGTTGCAGCCAAGAAGAGAAAGAAGGACATGCTG
AATAGCAAAACCAAAACTCAGTATTTCCACCAAGAAAAATGGATCTATGTTCACAAAGGAAGTACTAAA
GAGCGCCATGGATATTGCACCCTGGGGGAAGCTTTCAACAGACTGGACTTCTCAACTGCCATTCTGGAT
TCCAGAAGATTTAACTACGTGGTCCGGCCTGCCTTCAAAGGCCTCACCTTCACTGACCTGCCTTTGTGC
CTACAACTGAACATCATGCAGAGGCTGAGCGACGGGCGGGACCTGGTCAGCCTGGGCCAGGCTGCCCCC
GACCTGCACGTGCTCAGCGAAGACCGGCTGCTGTGGAAGAAACTCTGCCAGTACCACTTCTCCGAGCGG
CAGATCCGCAAACGATTAATTCTGTCAGACAAAGGGCAGCTGGATTGGAAGAAGATGTATTTCAAACTT
GTCCGATGTTACCCAAGGAAAGAGCAGTATGGAGATACCCTTCAGCTCTGCAAACACTGTCACATCCTT
TCCTGGAAGGGCACTGACCATCCGTGCACTGCCAATAACCCAGAGAGCTGCTCCGTTTCACTTTCACCC
CAGGACTTTATCAACTTGTTCAAGTTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001242463
Insert Size 789 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001242463.1
RefSeq Size 6521 bp
RefSeq ORF 789 bp
Locus ID 114907
UniProt ID Q969P5
MW 30.8 kDa
Gene Summary This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and contains an F-box domain. This protein is highly expressed during muscle atrophy, whereas mice deficient in this gene were found to be resistant to atrophy. This protein is thus a potential drug target for the treatment of muscle atrophy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011]
Transcript Variant: This variant (3) lacks two in-frame exons in the coding region, compared to variant 1. This encodes a shorter protein (isoform 3), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...