EDA2R (NM_001242310) Human Untagged Clone

CAT#: SC329918

EDA2R (untagged) - Homo sapiens ectodysplasin A2 receptor (EDA2R), transcript variant 3



  "NM_001242310" in other vectors (2)

CNY 3140.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
Rabbit Polyclonal Anti-EDA2R Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EDA-A2R; EDAA2R; TNFRSF27; XEDAR
Vector pCMV6-Entry
Sequence Data
>SC329918 representing NM_001242310.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGATTGCCAAGAAAATGAGTACTGGGACCAATGGGGACGGTGTGTCACCTGCCAACGGTGTGGTCCT
GGACAGGAGCTATCCAAGGATTGTGGTTATGGAGAGGGTGGAGATGCCTACTGCACAGCCTGCCCTCCT
CGCAGGTACAAAAGCAGCTGGGGCCACCACAGATGTCAGAGTTGCATCACCTGTGCTGTCATCAATCGT
GTTCAGAAGGTCAACTGCACAGCTACCTCTAATGCTGTCTGTGGGGACTGTTTGCCCAGGTTCTACCGA
AAGACACGCATTGGAGGCCTGCAGGACCAAGAGTGCATCCCGTGCACGAAGCAGACCCCCACCTCTGAG
GTTCAATGTGCCTTCCAGTTGAGCTTAGTGGAGGCAGATGCACCCACAGTGCCCCCTCAGGAGGCCACA
CTTGTTGCACTGGTGAGCAGCCTGCTAGTGGTGTTTACCCTGGCCTTCCTGGGGCTCTTCTTCCTCTAC
TGCAAGCAGTTCTTCAACAGACATTGCCAGCGTGAGAAATTGATTATTTTCTCTGATCCAGTACCAGCT
AGCCTCAATCTGATACCTGAATTTGCAGGAGGTTTGCTGCAGTTTGAGGCTGATAAAACAGCAAAGGAG
GAATCTCTCTTCCCCGTGCCACCCAGCAAGGAGACCAGTGCTGAGTCCCAAGTGAGTGAGAACATCTTT
CAGACCCAGCCACTTAACCCTATCCTCGAGGACGACTGCAGCTCGACTAGTGGCTTCCCCACACAGGAG
TCCTTTACCATGGCCTCCTGCACCTCAGAGAGCCACTCCCACTGGGTCCACAGCCCCATCGAATGCACA
GAGCTGGACCTGCAAAAGTTTTCCAGCTCTGCCTCCTATACTGGAGCTGAGACCTTGGGGGGAAACACA
GTCGAAAGCACTGGAGACAGGCTGGAGCTCAATGTGCCCTTTGAAGTTCCCAGCCCTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001242310
Insert Size 957 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001242310.1
RefSeq Size 3434 bp
RefSeq ORF 957 bp
Locus ID 60401
UniProt ID Q9HAV5
Protein Families Druggable Genome, Transcription Factors, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction
MW 35 kDa
Gene Summary The protein encoded by this gene is a type III transmembrane protein of the TNFR (tumor necrosis factor receptor) superfamily, and contains cysteine-rich repeats and a single transmembrane domain. This protein binds to the EDA-A2 isoform of ectodysplasin, which plays an important role in maintenance of hair and teeth. Alternatively spliced transcript variants encodes distinct protein isoforms. [provided by RefSeq, Apr 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...