Kallikrein 7 (KLK7) (NM_001207053) Human Untagged Clone

CAT#: SC329897

KLK7 (untagged) - Homo sapiens kallikrein-related peptidase 7 (KLK7), transcript variant 3



  "NM_001207053" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Anti-KLK7 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms hK7; PRSS6; SCCE
Vector pCMV6-Entry
Sequence Data
>SC329897 representing NM_001207053.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAATGAGTACACCGTGCACCTGGGCAGTGATACGCTGGGCGACAGGAGAGCTCAGAGGATCAAGGCC
TCGAAGTCATTCCGCCACCCCGGCTACTCCACACAGACCCATGTTAATGACCTCATGCTCGTGAAGCTC
AATAGCCAGGCCAGGCTGTCATCCATGGTGAAGAAAGTCAGGCTGCCCTCCCGCTGCGAACCCCCTGGA
ACCACCTGTACTGTCTCCGGCTGGGGCACTACCACGAGCCCAGATGTGACCTTTCCCTCTGACCTCATG
TGCGTGGATGTCAAGCTCATCTCCCCCCAGGACTGCACGAAGGTTTACAAGGACTTACTGGAAAATTCC
ATGCTGTGCGCTGGCATCCCCGACTCCAAGAAAAACGCCTGCAATGGTGACTCAGGGGGACCGTTGGTG
TGCAGAGGTACCCTGCAAGGTCTGGTGTCCTGGGGAACTTTCCCTTGCGGCCAACCCAATGACCCAGGA
GTCTACACTCAAGTGTGCAAGTTCACCAAGTGGATAAATGACACCATGAAAAAGCATCGCTAA

Restriction Sites SgfI-MluI     
ACCN NM_001207053
Insert Size 546 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001207053.1
RefSeq Size 1973 bp
RefSeq ORF 546 bp
Locus ID 5650
UniProt ID P49862
Protein Families Druggable Genome, Secreted Protein
MW 19.9 kDa
Gene Summary This gene encodes a member of the kallikrein subfamily of serine proteases. These enzymes have diverse physiological functions and many kallikrein genes are biomarkers for cancer. The encoded protein has chymotrypsin-like activity and plays a role in the proteolysis of intercellular cohesive structures that precedes desquamation, the shedding of the outermost layer of the epidermis. The encoded protein may play a role in cancer invasion and metastasis, and increased expression of this gene is associated with unfavorable prognosis and progression of several types of cancer. Polymorphisms in this gene may play a role in the development of atopic dermatitis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, which is one of fifteen kallikrein subfamily members located in a gene cluster on chromosome 19. [provided by RefSeq, May 2011]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream, in-frame start site, compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript sequence data to make the sequence consistent with the reference genome assembly, which represents the 'AACCAACC' allele with regards to the 3' UTR polymorphism described in PMID 15191543.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...