DHPS (NM_001206974) Human Untagged Clone

CAT#: SC329867

DHPS (untagged) - Homo sapiens deoxyhypusine synthase (DHPS), transcript variant 4



  "NM_001206974" in other vectors (2)

CNY 3230.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Anti-DHPS mouse monoclonal antibody, clone OTI2C9 (formerly 2C9)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DHS; DS; MIG13; NEDSSWI
Vector pCMV6-Entry
Sequence Data
>SC329867 representing NM_001206974.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCTATAATCCCAGCATTTTGGGAAGCCGAGGCGGGTGGATCAAGAGAAGAGGAGTTCGAGACAAGC
CTGGCCAACATGATCGAGAAGAAGCTGGAACCACTGTCACAGGATGAAGACCAGCACGCGGACCTGACC
CAGAGCCGCCGCCCACTTACCAGCTGCACCATTTTCCTGGGATATACATCCAACCTCATCAGTTCAGGC
ATCCGTGAGACCATTCGCTACCTTGTGCAGCACAACATGGTGGACGTATTGGTGACCACAGCTGGCGGC
GTGGAGGAAGACCTCATCAAGTGCCTGGCGCCCACATACTTGGGCGAGTTTAGCCTCAGGGGGAAGGAG
CTCCGGGAGAACGGGATCAATAGGATCGGAAACCTGCTGGTGCCCAATGAGAATTACTGCAAGTTTGAG
GACTGGCTGATGCCCATTCTGGACCAGATGGTGATGGAGCAGAACACAGAGGGTGTAAAGTGGACGCCT
TCTAAGATGATCGCCCGGCTGGGCAAGGAGATCAACAACCCAGAGTCCGTGTATTACTGGGCCCAGAAG
AACCACATCCCTGTGTTTAGTCCCGCACTTACAGACGGCTCGCTGGGCGACATGATCTTCTTCCATTCC
TACAAGAACCCGGGCCTGGTCCTGGACATCGTTGAGGACCTGAGGCTCATCAACACACAGGCCATCTTT
GCCAAGTGCACTGGGATGATCATTCTGGGCGGGGGCGTGGTCAAGCACCACATTGCCAATGCCAACCTC
ATGCGGAACGGGGCCGACTACGCTGTTTACATCAACACAGCCCAGGAGTTTGATGGCTCTGACTCAGGT
GCCCGACCAGACGAGGCTGTCTCCTGGGGCAAGATCCGGGTGGATGCACAGCCCGTCAAGGTCTATGCT
GACGCCTCCCTGGTCTTCCCCCTGCTTGTGGCTGAAACCTTTGCCCAGAAGATGGATGCCTTCATGCAT
GAGAAGAACGAGGACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001206974
Insert Size 984 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001206974.1
RefSeq Size 1212 bp
RefSeq ORF 984 bp
Locus ID 1725
UniProt ID P49366
MW 36.6 kDa
Gene Summary This gene encodes a protein that is required for the formation of hypusine, a unique amino acid formed by the posttranslational modification of only one protein, eukaryotic translation initiation factor 5A. The encoded protein catalyzes the first step in hypusine formation by transferring the butylamine moiety of spermidine to a specific lysine residue of the eukaryotic translation initiation factor 5A precursor, forming an intermediate deoxyhypusine residue. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2011]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (d) is shorter and has a distinct N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...