RAGE (AGER) (NM_001206954) Human Untagged Clone
CAT#: SC329863
AGER (untagged) - Homo sapiens advanced glycosylation end product-specific receptor (AGER), transcript variant 8
CNY 3140.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | RAGE; SCARJ1; sRAGE |
Vector | pCMV6-Entry |
Sequence Data |
>SC329863 representing NM_001206954.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCAGCCGGAACAGCAGTTGGAGCCTGGGTGCTGGTCCTCAGTCTGTGGGGGGCAGTAGTAGGTGCT CAAAACATCACAGCCCGGATTGGCGAGCCACTGGTGCTGAAGTGTAAGGGGGCCCCCAAGAAACCACCC CAGCGGCTGGAATGGAAACTGAACACAGGCCGGACAGAAGCTTGGAAGGTCCTGTCTCCCCAGGGAGGA GGCCCCTGGGACAGTGTGGCTCGTGTCCTTCCCAACGGCTCCCTCTTCCTTCCGGCTGTCGGGATCCAG GATGAGGGGATTTTCCGGTGCCAGGCAATGAACAGGAATGGAAAGGAGACCAAGTCCAACTACCGAGTC CGTGTCTACCAGATTCCTGGGAAGCCAGAAATTGTAGATTCTGCCTCTGAACTCACGGCTGGTGTTCCC AATAAGGTGGGGACATGTGTGTCAGAGGGAAGCTACCCTGCAGGGACTCTTAGCTGGCACTTGGATGGG AAGCCCCTGGTGCCTAATGAGAAGGGAGTATCTGTGAAGGAACAGACCAGGAGACACCCTGAGACAGGG CTCTTCACACTGCAGTCGGAGCTAATGGTGACCCCAGCCCGGGGAGGAGATCCCCGTCCCACCTTCTCC TGTAGCTTCAGCCCAGGCCTTCCCCGACACCGGGCCTTGCGCACAGCCCCCATCCAGCCCCGTGTCTGG GAGCCTGTGCCTCTGGAGGAGGTCCAATTGGTGGTGGAGCCAGAAGGTGGAGCAGTAGCTCCTGGTGGA ACCGTAACCCTGACCTGTGAAGTCCCTGCCCAGCCCTCTCCTCAAATCCACTGGATGAAGGATAACCAG GCGAGGAGGGGCCAACTGCAGGTGAGGGGTTTGATAAAGTCAGGGAAGCAGAAGATAGCCCCCAACACA TGTGACTGGGGGGATGGTCAACAAGAAAGGAATGGAAGGCCCCAGAAAACCAGGAGGAAGAGGAGGAGC GTGCAGAACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001206954 |
Insert Size | 978 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001206954.1 |
RefSeq Size | 1321 bp |
RefSeq ORF | 978 bp |
Locus ID | 177 |
UniProt ID | Q15109 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
MW | 35.3 kDa |
Gene Summary | The advanced glycosylation end product (AGE) receptor encoded by this gene is a member of the immunoglobulin superfamily of cell surface receptors. It is a multiligand receptor, and besides AGE, interacts with other molecules implicated in homeostasis, development, and inflammation, and certain diseases, such as diabetes and Alzheimer's disease. Many alternatively spliced transcript variants encoding different isoforms, as well as non-protein-coding variants, have been described for this gene (PMID:18089847). [provided by RefSeq, May 2011] Transcript Variant: This variant (8, also known as RAGE_v8) lacks two internal coding exons, and uses an alternate donor splice site at another coding exon compared to variant 1. This results in a frame-shift, and a shorter isoform (8) with a distinct C-terminus compared to isoform 1. Sequence Note: This Refseq, containing two in-frame translation initiation codons (at nt 8-10 and nt 101-103), is annotated with a CDS starting from the downstream AUG (dAUG) because the AGE receptor encoded by this gene is a known type 1 transmembrane protein requiring signal peptide for its function, and a signal peptide of 22 aa is predicted for the dAUG initiated protein. Translation initiation from the upstream AUG (uAUG) will add an extra 31 aa to the N-terminus, and no signal peptide is predicted for the uAUG initiated protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232484 | AGER (Myc-DDK tagged) - Homo sapiens advanced glycosylation end product-specific receptor (AGER), transcript variant 8 |
CNY 3990.00 |
|
RG232484 | AGER (tGFP-tagged) - Homo sapiens advanced glycosylation end product-specific receptor (AGER), transcript variant 8 |
CNY 4370.00 |