CAPZB (NM_001206540) Human Untagged Clone
CAT#: SC329816
CAPZB (untagged) - Homo sapiens capping protein (actin filament) muscle Z-line, beta (CAPZB), transcript variant 2
CNY 2950.00
Product images

CNY 6281.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CAPB; CAPPB; CAPZ |
Vector | pCMV6-Entry |
Sequence Data |
>SC329816 representing NM_001206540.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAGTGATCAGCAGCTGGACTGTGCCTTGGACCTAATGAGGCGCCTGCCTCCCCAGCAAATCGAGAAA AACCTCAGCGACCTGATCGACCTGGTCCCCAGTCTATGTGAGGATCTCCTGTCTTCTGTTGACCAGCCA CTGAAAATTGCCAGAGACAAGGTGGTGGGAAAGGATTACCTTTTGTGTGACTACAACAGAGATGGGGAC TCCTATAGGTCACCATGGAGTAACAAGTATGACCCTCCCTTGGAGGATGGGGCCATGCCGTCAGCTCGG CTGAGAAAGCTGGAGGTGGAAGCCAACAATGCCTTTGACCAGTATCGAGACCTGTATTTTGAAGGTGGC GTCTCATCTGTCTACCTCTGGGATCTGGATCATGGCTTTGCTGGAGTGATCCTCATAAAGAAGGCTGGA GATGGATCAAAGAAGATCAAAGGCTGCTGGGATTCCATCCACGTGGTAGAAGTGCAGGAGAAATCCAGC GGTCGCACCGCCCATTACAAGTTGACCTCCACGGTGATGCTGTGGCTGCAGACCAACAAATCTGGCTCT GGCACCATGAACCTCGGAGGCAGCCTTACCAGACAGATGGAGAAGGATGAAACTGTGAGTGACTGCTCC CCACACATAGCCAACATCGGGCGCCTGGTAGAGGACATGGAAAATAAAATCAGAAGTACGCTGAACGAG ATCTACTTTGGAAAAACAAAGGATATCGTCAATGGGCTGAGATCTATTGATGCTATCCCTGACAACCAA AAGTTTAAGCAGTTGCAGAGGGAGCTCTCTCAAGTGCTGACCCAGCGCCAGATCTACATCCAGCCTGAT AATTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001206540 |
Insert Size | 834 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001206540.2 |
RefSeq Size | 1910 bp |
RefSeq ORF | 834 bp |
Locus ID | 832 |
UniProt ID | P47756 |
MW | 31.4 kDa |
Gene Summary | This gene encodes the beta subunit of the barbed-end actin binding protein, which belongs to the F-actin capping protein family. The capping protein is a heterodimeric actin capping protein that blocks actin filament assembly and disassembly at the fast growing (barbed) filament ends and functions in regulating actin filament dynamics as well as in stabilizing actin filament lengths in muscle and nonmuscle cells. A pseudogene of this gene is located on the long arm of chromosome 2. Multiple alternatively spliced transcript variants encoding different isoforms have been found.[provided by RefSeq, Aug 2013] Transcript Variant: This variant (2) has an additional exon in the 3' region, and thus differs in the 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (2) has a longer and distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232359 | CAPZB (Myc-DDK tagged) - Homo sapiens capping protein (actin filament) muscle Z-line, beta (CAPZB), transcript variant 2 |
CNY 3990.00 |
|
RG232359 | CAPZB (tGFP-tagged) - Homo sapiens capping protein (actin filament) muscle Z-line, beta (CAPZB), transcript variant 2 |
CNY 4240.00 |