ATF3 (NM_001206486) Human Untagged Clone
CAT#: SC329812
ATF3 (untagged) - Homo sapiens activating transcription factor 3 (ATF3), transcript variant 7
CNY 2950.00
货期*
4周
规格
Product images

推荐一起购买 (4)
ATF3 mouse monoclonal antibody, clone OTI5G9 (formerly 5G9)
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
Sequence Data |
>SC329812 representing NM_001206486.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGATGCTTCAACACCCAGGCCAGGTCTCTGCCTCGGAAGAAGAGCTGAGGTTTGCCATCCAGAACAAG CACCTCTGCCACCGGATGTCCTCTGCGCTGGAATCAGTCACTGTCAGCGACAGACCCCTCGGGGTGTCC ATCACAAAAGCCGAGGTAGCCCCTGAAGAAGATGAAAGGAAAAAGAGGCGACGAGAAAGAAATAAGATT GCAGCTGCAAAGTGCCGAAACAAGAAGAAGGAGAAGACGGAGTGCCTGCAGAAACTCCCAAGGCCCTTT TGGGTCCAGAAGACCTGCATATGGGCTGTTGACTCATGCAAATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001206486 |
Insert Size | 321 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001206486.2 |
RefSeq Size | 2010 bp |
RefSeq ORF | 321 bp |
Locus ID | 467 |
UniProt ID | P18847 |
Protein Families | Transcription Factors |
MW | 12.3 kDa |
Gene Summary | This gene encodes a member of the mammalian activation transcription factor/cAMP responsive element-binding (CREB) protein family of transcription factors. This gene is induced by a variety of signals, including many of those encountered by cancer cells, and is involved in the complex process of cellular stress response. Multiple transcript variants encoding different isoforms have been found for this gene. It is possible that alternative splicing of this gene may be physiologically important in the regulation of target genes. [provided by RefSeq, Apr 2011] Transcript Variant: This variant (7) differs in the 5' UTR, lacks an in-frame segment of the 5' coding region, and contains an alternate terminal exon, thus differing in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (5, also known as deltaZip2c) has a distinct C-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...