EIF4A1 (NM_001204510) Human Untagged Clone

CAT#: SC329761

EIF4A1 (untagged) - Homo sapiens eukaryotic translation initiation factor 4A1 (EIF4A1), transcript variant 2



  "NM_001204510" in other vectors (2)

CNY 3330.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


eIF4A1 (6D7) Mouse monoclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DDX2A; EIF-4A; eIF-4A-I; EIF4A; eIF4A-I
Vector pCMV6-Entry
Sequence Data
>SC329761 representing NM_001204510.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCGATGGGATGGAGCCCGAAGGCGTCATC
GAGAGTAACTGGAATGAGATTGTTGACAGCTTTGATGACATGAACCTCTCGGAGTCCCTTCTCCGTGGC
ATCTACGCGTATGGTTTTGAGAAGCCCTCTGCCATCCAGCAGCGAGCCATTCTACCTTGTATCAAGGGT
TATGATGTGATTGCTCAAGCCCAATCTGGGACTGGGAAAACGGCCACATTTGCCATATCGATTCTGCAG
CAGATTGAATTAGATCTAAAAGCCACCCAGGCCTTGGTCCTAGCACCCACTCGAGAATTGGCTCAGCAG
ATACAGAAGGTGGTCATGGCACTAGGAGACTACATGGGCGCCTCCTGTCACGCCTGTATCGGGGGCACC
AACGTGCGTGCTGAGGTGCAGAAACTGCAGATGGAAGCTCCCCACATCATCGTGGGTACCCCTGGCCGT
GTGTTTGATATGCTTAACCGGAGATACCTGTCCCCCAAATACATCAAGATGTTTGTACTGGATGAAGCT
GACGAAATGTTAAGCCGTGGATTCAAGGACCAGATCTATGACATATTCCAAAAGCTCAACAGCAACACC
CAGGTAGTTTTGCTGTCAGCCACAATGCCTTCTGATGTGCTTGAGGTGACCAAGAAGTTCATGAGGGAC
CCCATTCGGATTCTTGTCAAGAAGGAAGAGTTGACCCTGGAGGGTATCCGCCAGTTCTACATCAACGTG
GAACGAGAGGAGTGGAAGCTGGACACACTATGTGACTTGTATGAAACCCTGACCATCACCCAGGCAGTC
ATCTTCATCAACACCCGGAGGAAGGTGGACTGGCTCACCGAGAAGATGCATGCTCGAGATTTCACTGTA
TCCGCCATGCATGGAGATATGGACCAAAAGGAACGAGACGTGATTATGAGGGAGTTTCGTTCTGGCTCT
AGCAGAGTTTTGATTACCACTGACCTGCTGGGAAAACTATATCCACAGAATCGGTCGAGGTGGACGGTT
TGGCCGTAA

Restriction Sites SgfI-RsrII     
ACCN NM_001204510
Insert Size 1044 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001204510.1
RefSeq Size 1832 bp
RefSeq ORF 1044 bp
Locus ID 1973
UniProt ID P60842
MW 39.5 kDa
Gene Summary ATP-dependent RNA helicase which is a subunit of the eIF4F complex involved in cap recognition and is required for mRNA binding to ribosome. In the current model of translation initiation, eIF4A unwinds RNA secondary structures in the 5'-UTR of mRNAs which is necessary to allow efficient binding of the small ribosomal subunit, and subsequent scanning for the initiator codon.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate splice site that causes a frameshift in the 3' coding region, compared to variant 1, resulting in an isoform (2) with a distinct and shorter C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...