EMA (MUC1) (NM_001204293) Human Untagged Clone
CAT#: SC329733
MUC1 (untagged) - Homo sapiens mucin 1, cell surface associated (MUC1), transcript variant 17
CNY 2950.00
货期*
4周
规格
Product images

推荐一起购买 (4)
MUC1 (EMA) mouse monoclonal antibody, clone OTI2F6 (formerly 2F6)
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ADMCKD; ADMCKD1; ADTKD2; CA 15-3; CD227; EMA; H23AG; KL-6; MAM6; MCD; MCKD; MCKD1; MUC-1; MUC-1/SEC; MUC-1/X; MUC1/ZD; PEM; PEMT; PUM |
Vector | pCMV6-Entry |
Sequence Data |
>SC329733 representing NM_001204293.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGACACCGGGCACCCAGTCTCCTTTCTTCCTGCTGCTGCTCCTCACAGTGCTTACAGTTGTTACGGGT TCTGGTCATGCAAGCTCTACCCCAGGTGGAGAAAAGGAGACTTCGGCTACCCAGAGAAGTTCAGTGCCC AGCTCTACTGAGAAGAATGCTTTGTCTACTGGGGTCTCTTTCTTTTTCCTGTCTTTTCACATTTCAAAC CTCCAGTTTAATTCCTCTCTGGAAGATCCCAGCACCGACTACTACCAAGAGCTGCAGAGAGACATTTCT GAAATGTTTTTGCAGATTTATAAACAAGGGGGTTTTCTGGGCCTCTCCAATATTAAGTTCAGGCCAGGA TCTGTGGTGGTACAATTGACTCTGGCCTTCCGAGAAGGTACCATCAATGTCCACGACGTGGAGACACAG TTCAATCAGTATAAAACGGAAGCAGCCTCTCGATATAACCTGACGATCTCAGACGTCAGCGGCTGTCTG TCAGTGCCGCCGAAAGAACTACGGGCAGCTGGACATCTTTCCAGCCCGGGATACCTACCATCCTATGAG CGAGTACCCCACCTACCACACCCATGGGCGCTATGTGCCCCCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001204293 |
Insert Size | 597 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001204293.1 |
RefSeq Size | 1098 bp |
RefSeq ORF | 597 bp |
Locus ID | 4582 |
UniProt ID | P15941 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
MW | 21.7 kDa |
Gene Summary | This gene encodes a membrane-bound protein that is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in intracellular signaling. This protein is expressed on the apical surface of epithelial cells that line the mucosal surfaces of many different tissues including lung, breast stomach and pancreas. This protein is proteolytically cleaved into alpha and beta subunits that form a heterodimeric complex. The N-terminal alpha subunit functions in cell-adhesion and the C-terminal beta subunit is involved in cell signaling. Overexpression, aberrant intracellular localization, and changes in glycosylation of this protein have been associated with carcinomas. This gene is known to contain a highly polymorphic variable number tandem repeats (VNTR) domain. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2011] Transcript Variant: This variant (17) lacks an exon in the 3' coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (17) is shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...