PREI3 (MOB4) (NM_001204094) Human Untagged Clone

CAT#: SC329704

MOB4 (untagged) - Homo sapiens MOB family member 4, phocein (MOB4), transcript variant 4



  "NM_001204094" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


MOB4 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 2C4D; CGI-95; MOB1; MOB3; MOBKL3; PHOCN; PREI3
Vector pCMV6-Entry
Sequence Data
>SC329704 representing NM_001204094.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGACAGTACACTAGCTGTTCAACAGTATATTCAACAGAACATAAGAGCAGATTGCTCCAATATTGAC
AAAATTCTTGAACCACCTGAAGGCCAAGATGAAGGTGTGTGGAAGTATGAACATTTAAGGCAGTTCTGC
CTTGAGCTAAATGGACTTGCTGTCAAACTTCAGAGTGAATGCCATCCAGATACTTGCACTCAAATGACA
GCAACTGAACAATGGATTTTTCTTTGTGCAGCTCATAAAACTCCAAAAGAGTGTCCTGCTATAGACTAT
ACTAGACACACACTTGATGGTGCTGCATGTCTTCTGAATAGCAATAAATATTTTCCCAGCAGGGTTAGC
ATAAAGGAATCATCTGTAGCGAAACTAGGATCAGTATGCCGTAGGATTTACAGAATATTTTCACATGCT
TATTTTCATCATCGGCAGATATTTGATGAATATGAAAATGAAACATTTTTGTGTCATCGGTTTACTAAG
TTTGTGATGAAATACAATTTGATGTCCAAGGATAACCTGATTGTACCAATTTTAGAAGAGGAAGTACAG
AATTCAGTTTCTGGGGAAAGTGAAGCATGA

Restriction Sites SgfI-MluI     
ACCN NM_001204094
Insert Size 582 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001204094.1
RefSeq Size 3742 bp
RefSeq ORF 582 bp
Locus ID 25843
UniProt ID Q9Y3A3
MW 22.3 kDa
Gene Summary This gene was identified based on its similarity with the mouse counterpart. Studies of the mouse counterpart suggest that the expression of this gene may be regulated during oocyte maturation and preimplantation following zygotic gene activation. Alternatively spliced transcript variants encoding distinct isoforms have been observed. Naturally occurring read-through transcription occurs between this locus and the neighboring locus HSPE1.[provided by RefSeq, Feb 2011]
Transcript Variant: This variant (4) uses an alternate exon at its 5' end compared to variant 1, resulting in a different 5' UTR and translation initiation at a downstream start codon. The resulting isoform (2) has a shorter N-terminus compared to isoform 1. Variants 2 and 4 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...