ANKS1B (NM_001204065) Human Untagged Clone
CAT#: SC329691
ANKS1B (untagged) - Homo sapiens ankyrin repeat and sterile alpha motif domain containing 1B (ANKS1B), transcript variant 4
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AIDA; AIDA-1; ANKS2; cajalin-2; EB-1; EB1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC329691 representing NM_001204065.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCAGGGCGATGCAAGGAGGAGAAGAAATGAAAACTACTTTGATGATATTCCCCGATCAAAACTGGAG AGGCAGATGGCTCAGTCGTCTGTCTGTGAAATATGGACGAATCAGAACGCAGGATTTCCTTTCTCAGCG ATCCATCAGGTTCATAATACAGGAGACTGGGGAGAACCTTCCATTACCTTGCGACCTCCGAATGAAGCC ACAGCCTCTACCCCGGTACAGTACTGGCAGCATCACCCAGAAAAGCTTATCTTCCAGTCGTGTGATTAC AAAGCTTTTTATTTAGGTTCTATGCTGATAAAAGAGCTTAGGGGGACAGAATCAACCCAAGATGCTTGT GCAAAAATGCGGGCTAACTGTCAGAAGTCTACAGAGCAAATGAAGAAGGTCCCTACTATTATTCTTTCT GTCTCATATAAAGGAGTCAAATTTATTGATGCAACAAATAAGAACATAATTGCTGAGCATGAAATTCGT AATATCTCCTGTGCTGCCCAGGACCCAGAAGACCTCTCAACATTTGCCTATATCACAAAAGATTTGAAG TCTAATCACCACTACTGTCATGTGTTTACTGCCTTTGATGTGAATTTAGCCTATGAAATCATCCTAACC CTGGGACAGGCATTCGAAGTCGCTTACCAGCTAGCACTACAAGCAAGAAAAGGGGGACACTCCTCCACA CTTCCAGAAAGCTTTGAAAACAAACCCTCCAAACCCATCCCCAAGCCCCGCGTTAGCATTCGCAAGTCC GTGCAGATCGACCCATCTGAGCAAAAGACTCTGGCCAATCTACCGTGGATTGTGGAGCCGGGCCAAGAA GCCAAGAGGGGCATTAATACCAAGTATGAAACCACGATTTTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001204065 |
Insert Size | 873 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001204065.1 |
RefSeq Size | 3199 bp |
RefSeq ORF | 873 bp |
Locus ID | 56899 |
UniProt ID | Q7Z6G8 |
MW | 32.9 kDa |
Gene Summary | This gene encodes a multi-domain protein that is predominantly expressed in brain and testis. This protein interacts with amyloid beta protein precursor (AbetaPP) and may have a role in normal brain development, and in the pathogenesis of Alzheimer's disease. Expression of this gene has been shown to be elevated in patients with pre-B cell acute lymphocytic leukemia associated with t(1;19) translocation. Alternatively spliced transcript variants encoding different isoforms (some with different subcellular localization, PMID:15004329) have been described for this gene. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (4) differs in the 5' UTR and coding region, in the 3' UTR and coding region, and contains an alternate in-frame exon compared to variant 1. The resulting isoform (d) has a shorter N-terminus, a longer and distinct C-terminus, and an additional segment compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232383 | ANKS1B (Myc-DDK tagged) - Homo sapiens ankyrin repeat and sterile alpha motif domain containing 1B (ANKS1B), transcript variant 4 |
CNY 3990.00 |
|
RG232383 | ANKS1B (tGFP-tagged) - Homo sapiens ankyrin repeat and sterile alpha motif domain containing 1B (ANKS1B), transcript variant 4 |
CNY 4370.00 |