ADK (NM_001202450) Human Untagged Clone

CAT#: SC329656

ADK (untagged) - Homo sapiens adenosine kinase (ADK), transcript variant 4



  "NM_001202450" in other vectors (2)

CNY 3040.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
ADK Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AK
Vector pCMV6-Entry
Sequence Data
>SC329656 representing NM_001202450.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCAGCTGCTGAGGAGGAGCCGAAGCCCAAAAAGCTGAAGGTGGAGGCGCCGCAAGCGCTGAGAGAA
AATATTCTCTTTGGAATGGGAAATCCTCTGCTTGACATCTCTGCTGTAGTGGACAAAGATTTCCTTGAT
AAGTATTCTCTGAAACCAAATGACCAAATCTTGGCTGAAGACAAACACAAGGAACTGTTTGATGAACTT
GTGAAAAAATTCAAAGTCGAATATCATGCTGGTGGCTCTACCCAGAATTCAATTAAAGTGGCTCAGTGG
ATGATTCAACAGCCACACAAAGCAGCAACATTTTTTGGATGCATTGGGATAGATAAATTTGGGGAGATC
CTGAAGAGAAAAGCTGCTGAAGCCCATGTGGATGCTCATTACTACGAGCAGAATGAGCAGCCAACAGGA
ACTTGTGCTGCATGCATCACTGGTGACAACAGGTCCCTCATAGCTAATCTTGCTGCTGCCAATTGTTAT
AAAAAGGAAAAACATCTTGATCTGGAGAAAAACTGGATGTTGGTAGAAAAAGCAAGAGTTTGTTATATA
GCAGAAGCTGCCACTTTTGCTAGAGAGCAAGGCTTTGAGACTAAAGACATTAAAGAGATAGCCAAAAAG
ACACAAGCCCTGCCAAAGATGAACTCAAAGAGGCAGCGAATCGTGATCTTCACCCAAGGGAGAGATGAC
ACTATAATGGCTACAGAAAGTGAAGTCACTGCTTTTGCTGTCTTGGATCAAGACCAGAAAGAAATTATT
GATACCAATGGAGCTGGAGATGCATTTGTTGGAGGTTTTCTGTCTCAACTGGTCTCTGACAAGCCTCTG
ACTGAATGTATCCGTGCTGGCCACTATGCAGCAAGCATCATAATTAGACGGACTGGCTGCACCTTTCCT
GAGAAGCCAGACTTCCACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001202450
Insert Size 918 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001202450.1
RefSeq Size 1878 bp
RefSeq ORF 918 bp
Locus ID 132
UniProt ID P55263
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Purine metabolism
MW 34.1 kDa
Gene Summary This gene an enzyme which catalyzes the transfer of the gamma-phosphate from ATP to adenosine, thereby serving as a regulator of concentrations of both extracellular adenosine and intracellular adenine nucleotides. Adenosine has widespread effects on the cardiovascular, nervous, respiratory, and immune systems and inhibitors of the enzyme could play an important pharmacological role in increasing intravascular adenosine concentrations and acting as anti-inflammatory agents. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (4) differs in the 5' UTR, initiates translation at an alternate start codon, and lacks an alternate in-frame exon in the coding region, compared to variant 1. This results in a shorter protein (isoform d), compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...