AKR1A1 (NM_001202414) Human Untagged Clone

CAT#: SC329650

AKR1A1 (untagged) - Homo sapiens aldo-keto reductase family 1, member A1 (aldehyde reductase) (AKR1A1), transcript variant 3



  "NM_001202414" in other vectors (2)

CNY 3140.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Anti-AKR1A1 mouse monoclonal antibody, clone OTI8H2 (formerly 8H2)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ALDR1; ALR; ARM; DD3; HEL-S-6
Vector pCMV6-Entry
Sequence Data
>SC329650 representing NM_001202414.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGGCTTCCTGTGTTCTACTGCACACTGGGCAGAAGATGCCTCTGATTGGTCTGGGTACCTGGAAG
AGTGAGCCTGGTCAGGTAAAAGCAGCTGTTAAGTATGCCCTTAGCGTAGGCTACCGCCACATTGATTGT
GCTGCTATCTACGGCAATGAGCCTGAGATTGGGGAGGCCCTGAAGGAGGACGTGGGACCAGGCAAGGCG
GTGCCTCGGGAGGAGCTGTTTGTGACATCCAAGCTGTGGAACACCAAGCACCACCCCGAGGATGTGGAG
CCTGCCCTCCGGAAGACTCTGGCTGACCTCCAGCTGGAGTATCTGGACCTGTACCTGATGCACTGGCCT
TATGCCTTTGAGCGGGGAGACAACCCCTTCCCCAAGAATGCTGATGGGACTATATGCTACGACTCCACC
CACTACAAGGAGACTTGGAAGGCTCTGGAGGCACTGGTGGCTAAGGGGCTGGTGCAGGCGCTGGGCCTG
TCCAACTTCAACAGTCGGCAGATTGATGACATACTCAGTGTGGCCTCCGTGCGTCCAGCTGTCTTGCAG
GTGGAATGCCACCCATACTTGGCTCAAAATGAGCTAATTGCCCACTGCCAAGCACGTGGCCTGGAGGTA
ACTGCTTATAGCCCTTTGGGCTCCTCTGATCGTGCATGGCGTGATCCTGATGAGCCTGTCCTGCTGGAG
GAACCAGTAGTCCTGGCATTGGCTGAAAAGTATGGCCGATCTCCAGCTCAGATCTTGCTCAGGTGGCAG
GTCCAGCGGAAAGTGATCTGCATCCCCAAAAGTATCACTCCTTCTCGAATCCTTCAGAACATCAAGGTG
TTTGACTTCACCTTTAGCCCAGAAGAGATGAAGCAGCTAAATGCCCTGAACAAAAATTGGAGATATATT
GTGCCTATGCTTACGGTGGATGGGAAGAGAGTCCCAAGGGATGCAGGGCATCCTCTGTACCCCTTTAAT
GACCCGTACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001202414
Insert Size 978 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001202414.1
RefSeq Size 1508 bp
RefSeq ORF 978 bp
Locus ID 10327
UniProt ID P14550
Protein Families Druggable Genome
Protein Pathways Glycerolipid metabolism, Glycolysis / Gluconeogenesis, Metabolic pathways
MW 36.6 kDa
Gene Summary This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member, also known as aldehyde reductase, is involved in the reduction of biogenic and xenobiotic aldehydes and is present in virtually every tissue. Multiple alternatively spliced transcript variants of this gene exist, all encoding the same protein. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. All variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...