SEC22C (NM_001201584) Human Untagged Clone
CAT#: SC329642
SEC22C (untagged) - Homo sapiens SEC22 vesicle trafficking protein homolog C (S. cerevisiae) (SEC22C), transcript variant 4
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | SEC22L3 |
Vector | pCMV6-Entry |
Sequence Data |
>SC329642 representing NM_001201584.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTCCGTGATCTTTTTTGCCTGCGTGGTACGGGTAAGGGATGGACTGCCCCTCTCAGCCTCTACTGAT TTTTACCACACCCAAGATTTTTTGGAATGGAGGAGACGGCTCAAGAGTTTAGCCTTGCGACTGGCCCAG TATCCAGGTCGAGGTTCTGCAGAAGGTTGTGACTTTAGTATACATTTTTCTTCTTTCGGGGACGTGGCC TGCATGGCTATCTGCTCCTGCCAGTGTCCAGCAGCCATGGCCTTCTGCTTCCTGGAGACCCTGTGGTGG GAATTCACAGCTTCCTATGACACTACCTGCATTGGCCTAGCCTCCAGGCCATACGCTTTTCTTGAGTTT GACAGCATCATTCAGAAAGTGAAGTGGCATTTTAACTATGTAAGTTCCTCTCAGATGGAGTGCAGCTTG GAAAAAATTCAGGAGGAGCTCAAGTTGCAGCCTCCAGCGGTTCTCACTCTGGAGGACACAGATGTGGCA AATGGGGTGATGAATGGTCACACACCGATGCACTTGGAGCCTGCTCCTAATTTCCGAATGGAACCAGTG ACAGCCCTGGGTATCCTCTCCCTCATTCTCAACATCATGTGTGCTGCCCTGAATCTCATTCGAGGAGTT CACCTTGCAGAACATTCTTTACAGGATCCAAGGAGCTGGTTCTGCTGGTTGGACCAAACCTCGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001201584 |
Insert Size | 687 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001201584.1 |
RefSeq Size | 1559 bp |
RefSeq ORF | 687 bp |
Locus ID | 9117 |
UniProt ID | Q9BRL7 |
Protein Families | Transmembrane |
MW | 25.7 kDa |
Gene Summary | This gene encodes a member of the SEC22 family of vesicle trafficking proteins. The encoded protein is localized to the endoplasmic reticulum and may play a role in the early stages of ER-Golgi protein trafficking. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (4) differs in the 3' UTR, lacks an exon in the 3' coding region and uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (c), is shorter and has a distinct C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232206 | SEC22C (Myc-DDK tagged) - Homo sapiens SEC22 vesicle trafficking protein homolog C (S. cerevisiae) (SEC22C), transcript variant 4 |
CNY 3990.00 |
|
RG232206 | SEC22C (tGFP-tagged) - Homo sapiens SEC22 vesicle trafficking protein homolog C (S. cerevisiae) (SEC22C), transcript variant 4 |
CNY 4370.00 |