AKAP associated Sperm Protein (ROPN1L) (NM_001201466) Human Untagged Clone
CAT#: SC329623
ROPN1L (untagged) - Homo sapiens rhophilin associated tail protein 1-like (ROPN1L), transcript variant 2
CNY 3840.00
货期*
现货
规格
Product images

推荐一起购买 (3)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ASP; RSPH11 |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001201466, the custom clone sequence may differ by one or more nucleotides
ATGCCGCTTCCCGACACCATGTTCTGCGCTCAGCAGATCCACATTCCCCCGGAGCTGCCGGACATCCTGA AGCAATTCACCAAGGCTGCCATCCGCACCCAGCCGGCCGACGTGCTGCGGTGGTCCGCGGGCTATTTTTC AGCTCTGTCGAGAGGAGATCCACTTCCTGTAAAGGACAGAATGGAAATGCCCACGGCAACCCAGAAAACA GACACAGGCCTGACTCAAGGACTCCTGAAAGTTTTGCACAAGCAGTGTCACCACAAGCGGTATGTGGAAT TAACAGATCTTGAGCAGAAGTGGAAGAACTTGTGCCTGCCGAAGGAAAAATTCAAAGCGCTCTTACAACT GGATCCTTGTGAAAACAAAATCAAGTGGATAAACTTTTTAGCGCTTGGATGCAGCATGCTTGGTGGGTCC TTGAACACTGCGCTGAAGCACCTGTGCGAGATCCTCACGGACGATCCGGAGGGCGGGCCCGCTCGCATCC CCTTCAAGACGTTTTCCTACGTTTACCGCTACTTGGCCAGATTAGACTCAGATGTGTCTCCCTTGGAGAC GGAATCCTACCTTGCCTCTCTAAAGGAAAATATAGACGCCAGGAAGAACGGCATGATAGGTCTTTCAGAT TTCTTCTTTCCAAAGAGGAAACTTTTAGAAAGCATTGAAAACTCTGAAGATGTAGGCCATTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001201466 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001201466.1, NP_001188395.1 |
RefSeq Size | 974 bp |
RefSeq ORF | 693 bp |
Locus ID | 83853 |
UniProt ID | Q96C74 |
Gene Summary | This gene encodes a member of the ropporin family. The encoded protein is present in sperm and interacts with A-kinase anchoring protein, AKAP3, through the amphipathic helix region of AKAP3. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2014] Transcript Variant: This variant (2) lacks a segment in the 5' UTR and encodes the same protein, as compared to variant 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
其它AKAP associated Sperm Protein产品
Customer
Reviews
Loading...