NMNAT3 (NM_001200047) Human Untagged Clone
CAT#: SC329613
NMNAT3 (untagged) - Homo sapiens nicotinamide nucleotide adenylyltransferase 3 (NMNAT3), transcript variant 2
CNY 2950.00
货期*
4周
规格
Product images

推荐一起购买 (3)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FKSG76; PNAT-3; PNAT3 |
Vector | pCMV6-Entry |
Sequence Data |
>SC329613 representing NM_001200047.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAAGAGCCGAATACCTGTGGTGCTCCTGGCCTGTGGCTCCTTTAACCCCATCACCAACATGCACCTG CGCATGTTTGAGGTGGCCAGAGATCACCTACACCAAACAGCTGTGCCTGAGCTGAAGCTTCTCTGTGGG GCAGACGTCTTGAAGACCTTCCAGACCCCCAACCTCTGGAAGGATGCGCACATCCAGGAAATAGTGGAG AAGTTTGGCTTGGTGTGCGTGGGCCGAGTAGGTCACGACCCAAAAGGTTACATCGCAGAATCTCCCATC CTACGGATGCACCAGCACAACATTCACCTGGCCAAGGAGCCTGTGCAGAATGAGATCAGTGCCACATAC ATCAGGCGAGCCTTGGGCCAAGGGCAGAGCGTAAAGTACCTGATTCCCGATGCTGTCATCACGTACATC AAGGACCATGGCCTCTACACCAAGGGCAGTACCTGGAAAGGCAAAAGCACCCAGAGCACTGAGGGCAAG ACAAGCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001200047 |
Insert Size | 492 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001200047.1 |
RefSeq Size | 1801 bp |
RefSeq ORF | 492 bp |
Locus ID | 349565 |
UniProt ID | Q96T66 |
Protein Pathways | Metabolic pathways, Nicotinate and nicotinamide metabolism |
MW | 18.3 kDa |
Gene Summary | This gene encodes a member of the nicotinamide/nicotinic acid mononucleotide adenylyltransferase family. These enzymes use ATP to catalyze the synthesis of nicotinamide adenine dinucleotide or nicotinic acid adenine dinucleotide from nicotinamide mononucleotide or nicotinic acid mononucleotide, respectively. The encoded protein is localized to mitochondria and may also play a neuroprotective role as a molecular chaperone. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (2) lacks three alternate in-frame exons in the 5' coding region, compared to variant 3. The encoded isoform (2) is shorter than isoform 3. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
Customer
Reviews
Loading...