IL7 (NM_001199887) Human Untagged Clone
CAT#: SC329590
IL7 (untagged) - Homo sapiens interleukin 7 (IL7), transcript variant 3
CNY 2950.00
货期*
4周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | IL-7 |
Vector | pCMV6-Entry |
Sequence Data |
>SC329590 representing NM_001199887.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTTCCATGTTTCTTTTAGGTATATCTTTGGACTTCCTCCCCTGATCCTTGTTCTGTTGCCAGTAGCA TCATCTGATTGTGATATTGAAGGTAAAGATGGCAAACAATATGAGAGTGTTCTAATGGTCAGCATCGAT CAATTATTGGACAGCATGAAAGAAATTGGTAGCAATTGCCTGAATAATGAATTTAACTTTTTTAAAAGA CATATCTGTGATGCTAATAAGGAAGGTATGTTTTTATTCCGTGCTGCTCGCAAGTTGAGGCAATTTCTT AAAATGAATAGCACTGGTGATTTTGATCTCCACTTATTAAAAGTTTCAGAAGGCACAACAATACTGTTG AACTGCACTGGCCAGGAAGAAAATAAATCTTTAAAGGAACAGAAAAAACTGAATGACTTGTGTTTCCTA AAGAGACTATTACAAGAGATAAAAACTTGTTGGAATAAAATTTTGATGGGCACTAAAGAACACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199887 |
Insert Size | 480 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001199887.1 |
RefSeq Size | 2035 bp |
RefSeq ORF | 480 bp |
Locus ID | 3574 |
UniProt ID | P13232 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Jak-STAT signaling pathway |
MW | 18.4 kDa |
Gene Summary | The protein encoded by this gene is a cytokine important for B and T cell development. This cytokine and the hepatocyte growth factor (HGF) form a heterodimer that functions as a pre-pro-B cell growth-stimulating factor. IL7 is found to be a cofactor for V(D)J rearrangement of the T cell receptor beta (TCRB) during early T cell development. This cytokine can be produced locally by intestinal epithelial and epithelial goblet cells, and may serve as a regulatory factor for intestinal mucosal lymphocytes. IL7 plays an essential role in lymphoid cell survival, and in the maintenance of naive and memory T cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their presence in normal tissues has not been confirmed. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection can be a potent inducer of proinflammatory cytokines and chemokines which may defend against the infection, but may also mediate destructive lung injury. Elevated serum IL7 levels, together with several other circulating cytokines and chemokines, has been found to be associated with the severity of Coronavirus Disease 19 (COVID-19). [provided by RefSeq, Jul 2020] Transcript Variant: This variant (3) lacks an in-frame exon in the 3' coding region, compared to variant 1, which results in a shorter isoform (3) compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...