RPL11 (NM_001199802) Human Untagged Clone

CAT#: SC329566

RPL11 (untagged) - Homo sapiens ribosomal protein L11 (RPL11), transcript variant 2



  "NM_001199802" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-RPL11 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DBA7; GIG34; L11; uL5
Vector pCMV6-Entry
Sequence Data
>SC329566 representing NM_001199802.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACTTCGCATCCGCAAACTCTGTCTCAACATC
TGTGTTGGGGAGAGTGGAGACAGACTGACGCGAGCAGCCAAGGTGTTGGAGCAGCTCACAGGGCAGACC
CCTGTGTTTTCCAAAGCTAGATACACTGTCAGATCCTTTGGCATCCGGAGAAATGAAAAGATTGCTGTC
CACTGCACAGTTCGAGGGGCCAAGGCAGAAGAAATCTTGGAGAAGGGTCTAAAGGTGCGGGAGTATGAG
TTAAGAAAAAACAACTTCTCAGATACTGGAAACTTTGGTTTTGGGATCCAGGAACACATCGATCTGGGT
ATCAAATATGACCCAAGCATTGGTATCTACGGCCTGGACTTCTATGTGGTGCTGGGTAGGCCAGGTTTC
AGCATCGCAGACAAGAAGCGCAGGACAGGCTGCATTGGGGCCAAACACAGAATCAGCAAAGAGGAGGCC
ATGCGCTGGTTCCAGCAGAAGTATGATGGGATCATCCTTCCTGGCAAATAA

Restriction Sites SgfI-MluI     
ACCN NM_001199802
Insert Size 534 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199802.1
RefSeq Size 641 bp
RefSeq ORF 534 bp
Locus ID 6135
UniProt ID P62913
Protein Pathways Ribosome
MW 20.1 kDa
Gene Summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L5P family of ribosomal proteins. It is located in the cytoplasm. The protein probably associates with the 5S rRNA. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (2) lacks 3 nts at an alternate splice site, as compared to variant 1. The resulting isoform (2) lacks an internal aa in the N-terminal region, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...