Proteasome 20S alpha 5 (PSMA5) (NM_001199772) Human Untagged Clone

CAT#: SC329559

PSMA5 (untagged) - Homo sapiens proteasome (prosome, macropain) subunit, alpha type, 5 (PSMA5), transcript variant 2



  "NM_001199772" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit anti-PSMA5 Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PSC5; ZETA
Vector pCMV6-Entry
Sequence Data
>SC329559 representing NM_001199772.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGCCCAGCAGCATTGAGAAAATTGTAGAGATTGATGCTCACATAGGTTGTGCCATGAGTGGGCTA
ATTGCTGATGCTAAGACTTTAATTGATAAAGCCAGAGTGGAGACACAGAACCACTGGTTCACCTACAAT
GAGACAATGACAGTGGAGAGTGTGACCCAAGCTGTGTCCAATCTGGCTTTGCAGTTTGGAGAAGAAGAT
GCAGATCCAGGTGCCATGTCTCGTCCCTTTGGAGTAGCATTATTATTTGGAGGAGTTGATGAGAAAGGA
CCCCAGCTGTTTCATATGGACCCATCTGGGACCTTTGTACAGTGTGATGCTCGAGCAATTGGCTCTGCT
TCAGAGGGTGCCCAGAGCTCCTTGCAAGAAGTTTACCACAAGTCTATGACTTTGAAAGAAGCCATCAAG
TCTTCACTCATCATCCTCAAACAAGTAATGGAGGAGAAGCTGAATGCAACAAACATTGAGCTAGCCACA
GTGCAGCCTGGCCAGAATTTCCACATGTTCACAAAGGAAGAACTTGAAGAGGTTATCAAGGACATTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001199772
Insert Size 552 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199772.1
RefSeq Size 3771 bp
RefSeq ORF 552 bp
Locus ID 5686
UniProt ID P28066
Protein Families Druggable Genome, Protease
Protein Pathways Proteasome
MW 20 kDa
Gene Summary The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (2) lacks an exon in the 5' region, resulting in a downstream AUG start codon, as compared to variant 1. The resulting isoform (2) is shorter at the N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...