Proteasome 20S alpha 5 (PSMA5) (NM_001199772) Human Untagged Clone
CAT#: SC329559
PSMA5 (untagged) - Homo sapiens proteasome (prosome, macropain) subunit, alpha type, 5 (PSMA5), transcript variant 2
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PSC5; ZETA |
Vector | pCMV6-Entry |
Sequence Data |
>SC329559 representing NM_001199772.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGAGCCCAGCAGCATTGAGAAAATTGTAGAGATTGATGCTCACATAGGTTGTGCCATGAGTGGGCTA ATTGCTGATGCTAAGACTTTAATTGATAAAGCCAGAGTGGAGACACAGAACCACTGGTTCACCTACAAT GAGACAATGACAGTGGAGAGTGTGACCCAAGCTGTGTCCAATCTGGCTTTGCAGTTTGGAGAAGAAGAT GCAGATCCAGGTGCCATGTCTCGTCCCTTTGGAGTAGCATTATTATTTGGAGGAGTTGATGAGAAAGGA CCCCAGCTGTTTCATATGGACCCATCTGGGACCTTTGTACAGTGTGATGCTCGAGCAATTGGCTCTGCT TCAGAGGGTGCCCAGAGCTCCTTGCAAGAAGTTTACCACAAGTCTATGACTTTGAAAGAAGCCATCAAG TCTTCACTCATCATCCTCAAACAAGTAATGGAGGAGAAGCTGAATGCAACAAACATTGAGCTAGCCACA GTGCAGCCTGGCCAGAATTTCCACATGTTCACAAAGGAAGAACTTGAAGAGGTTATCAAGGACATTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199772 |
Insert Size | 552 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001199772.1 |
RefSeq Size | 3771 bp |
RefSeq ORF | 552 bp |
Locus ID | 5686 |
UniProt ID | P28066 |
Protein Families | Druggable Genome, Protease |
Protein Pathways | Proteasome |
MW | 20 kDa |
Gene Summary | The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been found for this gene. [provided by RefSeq, Dec 2010] Transcript Variant: This variant (2) lacks an exon in the 5' region, resulting in a downstream AUG start codon, as compared to variant 1. The resulting isoform (2) is shorter at the N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231993 | PSMA5 (Myc-DDK tagged) - Homo sapiens proteasome (prosome, macropain) subunit, alpha type, 5 (PSMA5), transcript variant 2 |
CNY 3990.00 |
|
RG231993 | PSMA5 (tGFP-tagged) - Homo sapiens proteasome (prosome, macropain) subunit, alpha type, 5 (PSMA5), transcript variant 2 |
CNY 4370.00 |
其它Proteasome 20S alpha 5产品