GADD45A (NM_001199741) Human Untagged Clone
CAT#: SC329552
GADD45A (untagged) - Homo sapiens growth arrest and DNA-damage-inducible, alpha (GADD45A), transcript variant 2
CNY 2950.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DDIT1; GADD45 |
Vector | pCMV6-Entry |
Sequence Data |
>SC329552 representing NM_001199741.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGACTTTGGAGGAATTCTCGGCTGGAGAGCAGAAGACCGAAAGCGACCCCGATAACGTGGTGTTGTGC CTGCTGGCGGCGGACGAGGACGACGACAGAGATGTGGCTCTGCAGATCCACTTCACCCTGATCCAGGCG TTTTGCTGCGAGAACGACATCAACATCCTGCGCGTCAGCAACCCGGGCCGGCTGGCGGAGCTCCTGCTC TTGGAGACCGACGCTGGCCCCGCGGCGAGCGAGGGCGCCGAGCAGCCCCCGGACCTGCACTGCGTGCTG GTGACGAATCCACATTCATCTCAATGGAAGGATCCTGCCTTAAGTCAACTTATTTGTTTTTGCCGGGAA AGTCGCTACATGGATCAATGGGTTCCAGTGATTAATCTCCCTGAACGGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199741 |
Insert Size | 396 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001199741.1 |
RefSeq Size | 1296 bp |
RefSeq ORF | 396 bp |
Locus ID | 1647 |
UniProt ID | P24522 |
Protein Families | Druggable Genome, Stem cell - Pluripotency |
Protein Pathways | Cell cycle, MAPK signaling pathway, p53 signaling pathway |
MW | 14.6 kDa |
Gene Summary | This gene is a member of a group of genes whose transcript levels are increased following stressful growth arrest conditions and treatment with DNA-damaging agents. The protein encoded by this gene responds to environmental stresses by mediating activation of the p38/JNK pathway via MTK1/MEKK4 kinase. The DNA damage-induced transcription of this gene is mediated by both p53-dependent and -independent mechanisms. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.[provided by RefSeq, Dec 2010] Transcript Variant: This variant (2) lacks an in-frame exon in the CDS and encodes a shorter isoform (2), as compared to variant 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231752 | GADD45A (Myc-DDK tagged) - Homo sapiens growth arrest and DNA-damage-inducible, alpha (GADD45A), transcript variant 2 |
CNY 3990.00 |
|
RG231752 | GADD45A (tGFP-tagged) - Homo sapiens growth arrest and DNA-damage-inducible, alpha (GADD45A), transcript variant 2 |
CNY 4370.00 |
其它GADD45A产品