IL33 (NM_001199640) Human Untagged Clone

CAT#: SC329543

IL33 (untagged) - Homo sapiens interleukin 33 (IL33), transcript variant 2



  "NM_001199640" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


IL33 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C9orf26; DVS27; IL1F11; NF-HEV; NFEHEV
Vector pCMV6-Entry
Sequence Data
>SC329543 representing NM_001199640.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAGCCTAAAATGAAGTATTCAACCAACAAAATTTCCACAGCAAAGTGGAAGAACACAGCAAGCAAA
GCCTTGTGTTTCAAGCTGGGAAAATCCCAACAGAAGGCCAAAGAAGTTTGCCCCATGTACTTTATGAAG
CTCCGCTCTGGCCTTATGATAAAAAAGGAGGCCTGTTACTTTAGGAGAGAAACCACCAAAAGGCCTTCA
CTGAAAACAGGTAGAAAGCACAAAAGACATCTGGTACTCGCTGCCTGTCAACAGCAGTCTACTGTGGAG
TGCTTTGCCTTTGGTATATCAGGGGTCCAGAAATATACTAGAGCACTTCATGATTCAAGTATCACAGAT
AAGGTGTTACTGAGTTACTATGAGTCTCAACACCCCTCAAATGAATCAGGTGACGGTGTTGATGGTAAG
ATGTTAATGGTAACCCTGAGTCCTACAAAAGACTTCTGGTTGCATGCCAACAACAAGGAACACTCTGTG
GAGCTCCATAAGTGTGAAAAACCACTGCCAGACCAGGCCTTCTTTGTCCTTCATAATATGCACTCCAAC
TGTGTTTCATTTGAATGCAAGACTGATCCTGGAGTGTTTATAGGTGTAAAGGATAATCATCTTGCTCTG
ATTAAAGTAGACTCTTCTGAGAATTTGTGTACTGAAAATATCTTGTTTAAGCTCTCTGAAACTTAG

Restriction Sites SgfI-MluI     
ACCN NM_001199640
Insert Size 687 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199640.1
RefSeq Size 2592 bp
RefSeq ORF 687 bp
Locus ID 90865
UniProt ID O95760
Protein Families Secreted Protein
Protein Pathways Cytosolic DNA-sensing pathway
MW 25.9 kDa
Gene Summary The protein encoded by this gene is a cytokine that binds to the IL1RL1/ST2 receptor. The encoded protein is involved in the maturation of Th2 cells and the activation of mast cells, basophils, eosinophils and natural killer cells. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (b, also known as 2) has the same N- and C-termini but is shorter compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...