SGK2 (NM_001199264) Human Untagged Clone

CAT#: SC329502

SGK2 (untagged) - Homo sapiens serum/glucocorticoid regulated kinase 2 (SGK2), transcript variant 3



  "NM_001199264" in other vectors (2)

CNY 3520.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


SGK2 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms dJ138B7.2; H-SGK2
Vector pCMV6-Entry
Sequence Data
>SC329502 representing NM_001199264.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAACTCTAGCCCAGCTGGGACCCCAAGTCCACAGCCCTCCAGGGCCAATGGGAACATCAACCTGGGG
CCTTCAGCCAACCCAAATGCCCAGCCCACGGACTTCGACTTCCTCAAAGTCATCGGCAAAGGGAACTAC
GGGAAGGTCCTACTGGCCAAGCGCAAGTCTGATGGGGCGTTCTATGCAGTGAAGGTACTACAGAAAAAG
TCCATCTTAAAGAAGAAAGAGCAGAGCCACATCATGGCAGAGCGCAGTGTGCTTCTGAAGAACGTGCGG
CACCCCTTCCTCGTGGGCCTGCGCTACTCCTTCCAGACACCTGAGAAGCTCTACTTCGTGCTCGACTAT
GTCAACGGGGGAGAGCTCTTCTTCCACCTGCAGCGGGAGCGCCGGTTCCTGGAGCCCCGGGCCAGGTTC
TACGCTGCTGAGGTGGCCAGCGCCATTGGCTACCTGCACTCCCTCAACATCATTTACAGGGATCTGAAA
CCAGAGAACATTCTCTTGGACTGCCAGGGACACGTGGTGCTGACGGATTTTGGCCTCTGCAAGGAAGGT
GTAGAGCCTGAAGACACCACATCCACATTCTGTGGTACCCCTGAGTACTTGGCACCTGAAGTGCTTCGG
AAAGAGCCTTATGATCGAGCAGTGGACTGGTGGTGCTTGGGGGCAGTCCTCTACGAGATGCTCCATGGC
CTGCCGCCCTTCTACAGCCAAGATGTATCCCAGATGTATGAGAACATTCTGCACCAGCCGCTACAGATC
CCCGGAGGCCGGACAGTGGCCGCCTGTGACCTCCTGCAAAGCCTTCTCCACAAGGACCAGAGGCAGCGG
CTGGGCTCCAAAGCAGACTTTCTTGAGATTAAGAACCATGTATTCTTCAGCCCCATAAACTGGGATGAC
CTGTACCACAAGAGGCTAACTCCACCCTTCAACCCAAATGTGACAGGACCTGCTGACTTGAAGCATTTT
GACCCAGAGTTCACCCAGGAAGCTGTGTCCAAGTCCATTGGCTGTACCCCTGACACTGTGGCCAGCAGC
TCTGGGGCCTCAAGTGCATTCCTGGGATTTTCTTATGCGCCAGAGGATGATGACATCTTGGATTGCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001199264
Insert Size 1104 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199264.1
RefSeq Size 1942 bp
RefSeq ORF 1104 bp
Locus ID 10110
UniProt ID Q9HBY8
Protein Families Druggable Genome, Protein Kinase
MW 41.2 kDa
Gene Summary This gene encodes a serine/threonine protein kinase. Although this gene product is similar to serum- and glucocorticoid-induced protein kinase (SGK), this gene is not induced by serum or glucocorticoids. This gene is induced in response to signals that activate phosphatidylinositol 3-kinase, which is also true for SGK. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
Transcript Variant: This variant (3) contains an alternate in-frame exon in the 5' coding region, compared to variant 2. Variants 1 and 3 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...