DDIT3 (NM_001195057) Human Untagged Clone

CAT#: SC329448

DDIT3 (untagged) - Homo sapiens DNA-damage-inducible transcript 3 (DDIT3), transcript variant 6



  "NM_001195057" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
DDIT3 mouse monoclonal antibody,clone OTI3H7
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AltDDIT3; C/EBPzeta; CEBPZ; CHOP; CHOP-10; CHOP10; GADD153
Vector pCMV6-Entry
Sequence Data
>SC329448 representing NM_001195057.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCAGCTGAGTCATTGCCTTTCTCCTTCGGGACACTGTCCAGCTGGGAGCTGGAAGCCTGGTATGAG
GACCTGCAAGAGGTCCTGTCTTCAGATGAAAATGGGGGTACCTATGTTTCACCTCCTGGAAATGAAGAG
GAAGAATCAAAAATCTTCACCACTCTTGACCCTGCTTCTCTGGCTTGGCTGACTGAGGAGGAGCCAGAA
CCAGCAGAGGTCACAAGCACCTCCCAGAGCCCTCACTCTCCAGATTCCAGTCAGAGCTCCCTGGCTCAG
GAGGAAGAGGAGGAAGACCAAGGGAGAACCAGGAAACGGAAACAGAGTGGTCATTCCCCAGCCCGGGCT
GGAAAGCAGCGCATGAAGGAGAAAGAACAGGAGAATGAAAGGAAAGTGGCACAGCTAGCTGAAGAGAAT
GAACGGCTCAAGCAGGAAATCGAGCGCCTGACCAGGGAAGTAGAGGCGACTCGCCGAGCTCTGATTGAC
CGAATGGTGAATCTGCACCAAGCATGA

Restriction Sites SgfI-MluI     
ACCN NM_001195057
Insert Size 510 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001195057.1
RefSeq Size 910 bp
RefSeq ORF 510 bp
Locus ID 1649
UniProt ID P35638
Protein Families Druggable Genome, Transcription Factors
Protein Pathways MAPK signaling pathway
MW 19.2 kDa
Gene Summary This gene encodes a member of the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors. The protein functions as a dominant-negative inhibitor by forming heterodimers with other C/EBP members, such as C/EBP and LAP (liver activator protein), and preventing their DNA binding activity. The protein is implicated in adipogenesis and erythropoiesis, is activated by endoplasmic reticulum stress, and promotes apoptosis. Fusion of this gene and FUS on chromosome 16 or EWSR1 on chromosome 22 induced by translocation generates chimeric proteins in myxoid liposarcomas or Ewing sarcoma. Multiple alternatively spliced transcript variants encoding two isoforms with different length have been identified. [provided by RefSeq, Aug 2010]
Transcript Variant: This variant (6) lacks an internal segment in the 5' region, resulting in a downstream AUG start codon, as compared to variant 1. The resulting isoform (2) is shorter at the N-terminus, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...