Hyaluronidase PH20 (SPAM1) (NM_001174046) Human Untagged Clone
CAT#: SC328842
SPAM1 (untagged)-Human sperm adhesion molecule 1 (PH-20 hyaluronidase zona pellucida binding) (SPAM1) transcript variant 5
CNY 8270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HEL-S-96n; HYA1; HYAL1; HYAL3; HYAL5; PH-20; PH20; SPAG15 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001174046, the custom clone sequence may differ by one or more nucleotides
ATGGGAGTGCTAAAATTCAAGCACATCTTTTTCAGAAGCTTTGTTAAATCAAGTGGAGTA TCCCAGATAGTTTTCACCTTCCTTCTGATTCCATGTTGCTTGACTCTGAATTTCAGAGCA CCTCCTGTTATTCCAAATGTGCCTTTCCTCTGGGCCTGGAATGCCCCAAGTGAATTTTGT CTTGGAAAATTTGATGAGCCACTAGATATGAGCCTCTTCTCTTTCATAGGAAGCCCCCGA ATAAACGCCACCGGGCAAGGTGTTACAATATTTTATGTTGATAGACTTGGCTACTATCCT TACATAGATTCAATCACAGGAGTAACTGTGAATGGAGGAATCCCCCAGAAGATTTCCTTA CAAGACCATCTGGACAAAGCTAAGAAAGACATTACATTTTATATGCCAGTAGACAATTTG GGAATGGCTGTTATTGACTGGGAAGAATGGAGACCCACTTGGGCAAGAAACTGGAAACCT AAAGATGTTTACAAGAATAGGTCTATTGAATTGGTTCAGCAACAAAATGTACAACTTAGT CTCACAGAGGCCACTGAGAAAGCAAAACAAGAATTTGAAAAGGCAGGGAAGGATTTCCTG GTAGAGACTATAAAATTGGGAAAATTACTTCGGCCAAATCACTTGTGGGGTTATTATCTT TTTCCGGATTGTTACAACCATCACTATAAGAAACCCGGTTACAATGGAAGTTGCTTCAAT GTAGAAATAAAAAGAAATGATGATCTCAGCTGGTTGTGGAATGAAAGCACTGCTCTTTAC CCATCCATTTATTTGAACACTCAGCAGTCTCCTGTAGCTGCTACACTCTATGTGCGCAAT CGAGTTCGGGAAGCCATCAGAGTTTCCAAAATACCTGATGCAAAAAGTCCACTTCCGGTT TTTGCATATACCCGCATAGTTTTTACTGATCAAGTTTTGAAATTCCTTTCTCAAGATGAA CTTGTGTATACATTTGGCGAAACTGTTGCTCTGGGTGCTTCTGGAATTGTAATATGGGGA ACCCTCAGTATAATGCGAAGTATGAAATCTTGCTTGCTCCTAGACAATTACATGGAGACT ATACTGAATCCTTACATAATCAACGTCACACTAGCAGCCAAAATGTGTAGCCAAGTGCTT TGCCAGGAGCAAGGAGTGTGTATAAGGAAAAACTGGAATTCAAGTGACTATCTTCACCTC AACCCAGATAATTTTGCTATTCAACTTGAGAAAGGTGGAAAGTTCACAGTACGTGGAAAA CCGACACTTGAAGACCTGGAGCAATTTTCTGAAAAATTTTATTGCAGCTGTTATAGCACC TTGAGTTGTAAGGAGAAAGCTGATGTAAAAGACACTGATGCTGTTGATGTGTGTATTGCT GATGGTGTCTGTATAGATGCTTTTCTAAAACCTCCCATGGAGACAGAAGAACCTCAAATT TTCTACAATGCTTCACCCTCCACACTATCTGCCACAATGTTCATTGTTAGTATTTTGTTT CTTATCATTTCTTCTGTAGCGAGTTTGTAA |
Restriction Sites | Please inquire |
ACCN | NM_001174046 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001174046.1, NP_001167517.1 |
RefSeq Size | 2151 bp |
RefSeq ORF | 1530 bp |
Locus ID | 6677 |
UniProt ID | P38567 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Glycosaminoglycan degradation, Metabolic pathways |
Gene Summary | Hyaluronidase degrades hyaluronic acid, a major structural proteoglycan found in extracellular matrices and basement membranes. Six members of the hyaluronidase family are clustered into two tightly linked groups on chromosome 3p21.3 and 7q31.3. This gene was previously referred to as HYAL1 and HYA1 and has since been assigned the official symbol SPAM1; another family member on chromosome 3p21.3 has been assigned HYAL1. This gene encodes a GPI-anchored enzyme located on the human sperm surface and inner acrosomal membrane. This multifunctional protein is a hyaluronidase that enables sperm to penetrate through the hyaluronic acid-rich cumulus cell layer surrounding the oocyte, a receptor that plays a role in hyaluronic acid induced cell signaling, and a receptor that is involved in sperm-zona pellucida adhesion. Abnormal expression of this gene in tumors has implicated this protein in degradation of basement membranes leading to tumor invasion and metastasis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010] Transcript Variant: This variant (5) differs in the 5' UTR and uses an alternate splice pattern in the 3' coding region and 3' UTR, compared to variant 1, resulting in a shorter and distinct C-terminus (isoform 2). Variants 2-5 all encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC230204 | SPAM1 (Myc-DDK-tagged)-Human sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding) (SPAM1), transcript variant 5 |
CNY 3792.00 |
|
RC230204L3 | Lenti-ORF clone of SPAM1 (Myc-DDK-tagged)-Human sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding) (SPAM1), transcript variant 5 |
CNY 6370.00 |
|
RC230204L4 | Lenti-ORF clone of SPAM1 (mGFP-tagged)-Human sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding) (SPAM1), transcript variant 5 |
CNY 6370.00 |
|
RG230204 | SPAM1 (tGFP-tagged) - Human sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding) (SPAM1), transcript variant 5 |
CNY 4940.00 |
其它Hyaluronidase PH20产品