HCK (NM_001172129) Human Untagged Clone
CAT#: SC328831
HCK (untagged)-Human hemopoietic cell kinase (HCK) transcript variant 1
CNY 7220.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | JTK9; p59Hck; p61Hck |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001172129, the custom clone sequence may differ by one or more nucleotides
ATGGGGTGCATGAAGTCCAAGTTCCTCCAGGTCGGAGGCAATACATTCTCAAAAACTGAA ACCAGCGCCAGCCCACACTGTCCTGTGTACGTGCCGGATCCCACATCCACCATCAAGCCG GGGCCTAATAGCCACAACAGCAACACACCAGGAATCAGGGAGGCAGGCTCTGAGGACATC ATCGTGGTTGCCCTGTATGATTACGAGGCCATTCACCACGAAGACCTCAGCTTCCAGAAG GGGGACCAGATGGTGGTCCTAGAGGAATCCGGGGAGTGGTGGAAGGCTCGATCCCTGGCC ACCCGGAAGGAGGGCTACATCCCAAGCAACTATGTCGCCCGCGTTGACTCTCTGGAGACA GAGGAGTGGTTTTTCAAGGGCATCAGCCGGAAGGACGCAGAGCGCCAACTGCTGGCTCCC GGCAACATGCTGGGCTCCTTCATGATCCGGGATAGCGAGACCACTAAAGGAAGCTACTCT TTGTCCGTGCGAGACTACGACCCTCGGCAGGGAGATACCGTGAAACATTACAAGATCCGG ACCCTGGACAACGGGGGCTTCTACATATCCCCCCGAAGCACCTTCAGCACTCTGCAGGAG CTGGTGGACCACTACAAGAAGGGGAACGACGGGCTCTGCCAGAAACTGTCGGTGCCCTGC ATGTCTTCCAAGCCCCAGAAGCCTTGGGAGAAAGATGCCTGGGAGATCCCTCGGGAATCC CTCAAGCTGGAGAAGAAACTTGGAGCTGGGCAGTTTGGGGAAGTCTGGATGGCCACCTAC AACAAGCACACCAAGGTGGCAGTGAAGACGATGAAGCCAGGGAGCATGTCGGTGGAGGCC TTCCTGGCAGAGGCCAACGTGATGAAAACTCTGCAGCATGACAAGCTGGTCAAACTTCAT GCGGTGGTCACCAAGGAGCCCATCTACATCATCACGGAGTTCATGGCCAAAGGAAGCTTG CTGGACTTTCTGAAAAGTGATGAGGGCAGCAAGCAGCCATTGCCAAAACTCATTGACTTC TCAGCCCAGATTGCAGAAGGCATGGCCTTCATCGAGCAGAGGAACTACATCCACCGAGAC CTCCGAGCTGCCAACATCTTGGTCTCTGCATCCCTGGTGTGTAAGATTGCTGACTTTGGC CTGGCCCGGGTCATTGAGGACAACGAGTACACGGCTCGGGAAGGGGCCAAGTTCCCCATC AAGTGGACAGCTCCTGAAGCCATCAACTTTGGCTCCTTCACCATCAAGTCAGACGTCTGG TCCTTTGGTATCCTGCTGATGGAGATCGTCACCTACGGCCGGATCCCTTACCCAGGGATG TCAAACCCTGAAGTGATCCGAGCTCTGGAGCGTGGATACCGGATGCCTCGCCCAGAGAAC TGCCCAGAGGAGCTCTACAACATCATGATGCGCTGCTGGAAAAACCGTCCGGAGGAGCGG CCGACCTTCGAATACATCCAGAGTGTGCTGGATGACTTCTACACGGCCACAGAGAGCCAG TACCAACAGCAGCCATGA |
Restriction Sites | Please inquire |
ACCN | NM_001172129 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001172129.1, NP_001165600.1 |
RefSeq Size | 2168 bp |
RefSeq ORF | 1518 bp |
Locus ID | 3055 |
UniProt ID | P08631 |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | Chemokine signaling pathway, Fc gamma R-mediated phagocytosis |
Gene Summary | The protein encoded by this gene is a member of the Src family of tyrosine kinases. This protein is primarily hemopoietic, particularly in cells of the myeloid and B-lymphoid lineages. It may help couple the Fc receptor to the activation of the respiratory burst. In addition, it may play a role in neutrophil migration and in the degranulation of neutrophils. Multiple isoforms with different subcellular distributions are produced due to both alternative splicing and the use of alternative translation initiation codons, including a non-AUG (CUG) codon. [provided by RefSeq, Feb 2010] Transcript Variant: This variant (1) encodes two isoforms due to the use of alternative translation initiation codons, as demonstrated in PMIDs 1875927 and 7791757. The longer isoform (a, also known as p61HCK) is derived from an upstream non-AUG (CUG) start codon, while the shorter isoform (b, also known as p59HCK) is derived from a downstream AUG start codon. The shorter isoform (b) is represented in this RefSeq. Both variants 1 and 4 encode isoform b. CCDS Note: This CCDS, which is supported by the mRNAs AK026432.1, BC108930.1 and others, represents a short human HCK isoform, known as p59HCK, as described in PMID:7791757. This isoform initiates translation from a downstream AUG start codon. Alternative translation initiation from an upstream non-AUG (CUG) start codon, which is well-conserved and present in a strong Kozak signal context, produces an isoform that is 21 aa longer at the N-terminus. The longer isoform, which is known as p61HCK, is represented by CCDS 33460.1. These isoforms exhibit distinct subcellular localization, as indicated in PMID:7791757. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC230193 | HCK (Myc-DDK-tagged)-Human hemopoietic cell kinase (HCK), transcript variant 1 |
CNY 3760.00 |
|
RC230193L3 | Lenti-ORF clone of HCK (Myc-DDK-tagged)-Human hemopoietic cell kinase (HCK), transcript variant 1 |
CNY 6160.00 |
|
RC230193L4 | Lenti-ORF clone of HCK (mGFP-tagged)-Human hemopoietic cell kinase (HCK), transcript variant 1 |
CNY 5890.00 |
|
RG230193 | HCK (tGFP-tagged) - Human hemopoietic cell kinase (HCK), transcript variant 1 |
CNY 4370.00 |