TFEB (NM_001167827) Human Untagged Clone

CAT#: SC328779

TFEB (untagged)-Human transcription factor EB (TFEB) transcript variant 2



  "NM_001167827" in other vectors (6)

CNY 5488.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TFEB Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ALPHATFEB; BHLHE35; TCFEB
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001167827, the custom clone sequence may differ by one or more nucleotides


ATGACAGCAAGCTCAGGCTGGGAGCCAGCGCCGGCAGCCACCATGGCGTCACGCATAGGGTTGCGCATGC
AGCTCATGCGGGAGCAGGCGCAGCAGGAGGAGCAGCGGGAGCGCATGCAGCAACAGGCTGTCATGCATTA
CATGCAGCAGCAGCAGCAGCAGCAACAGCAGCAGCTCGGAGGGCCGCCCACCCCGGCCATCAATACCCCC
GTCCACTTCCAGTCGCCACCACCTGTGCCTGGGGAGGTGTTGAAGGTGCAGTCCTACCTGGAGAATCCCA
CATCCTACCATCTGCAGCAGTCGCAGCATCAGAAGGTGCGGGAGTACCTGTCCGAGACCTATGGGAACAA
GTTTGCTGCCCACATCAGCCCAGCCCAGGGCTCTCCGAAACCCCCACCAGCCGCCTCCCCAGGGGTGCGA
GCTGGACACGTGCTGTCCTCCTCCGCTGGCAACAGTGCTCCCAATAGCCCCATGGCCATGCTGCACATTG
GCTCCAACCCTGAGAGGGAGTTGGATGATGTCATTGACAACATTATGCGTCTGGACGATGTCCTTGGCTA
CATCAATCCTGAAATGCAGATGCCCAACACGCTACCCCTGTCCAGCAGCCACCTGAATGTGTACAGCAGC
GACCCCCAGGTCACAGCCTCCCTGGTGGGCGTCACCAGCAGCTCCTGCCCTGCGGACCTGACCCAGAAGC
GAGAGCTCACAGATGCTGAGAGCAGGGCCCTGGCCAAGGAGCGGCAGAAGAAAGACAATCACAACTTAAT
TGAAAGGAGACGAAGGTTCAACATCAATGACCGCATCAAGGAGTTGGGAATGCTGATCCCCAAGGCCAAT
GACCTGGACGTGCGCTGGAACAAGGGCACCATCCTCAAGGCCTCTGTGGATTACATCCGGAGGATGCAGA
AGGACCTGCAAAAGTCCAGGGAGCTGGAGAACCACTCTCGCCGCCTGGAGATGACCAACAAGCAGCTCTG
GCTCCGTATCCAGGAGCTGGAGATGCAGGCTCGAGTGCACGGCCTCCCTACCACCTCCCCGTCCGGCATG
AACATGGCTGAGCTGGCCCAGCAGGTGGTGAAGCAGGAGCTGCCTAGCGAAGAGGGCCCAGGGGAGGCCC
TGATGCTGGGGGCTGAGGTCCCTGACCCTGAGCCACTGCCAGCTCTGCCCCCGCAAGCCCCGCTGCCCCT
GCCCACCCAGCCACCATCCCCATTCCATCACCTGGACTTCAGCCACAGCCTGAGCTTTGGGGGCAGGGAG
GACGAGGGTCCCCCGGGCTACCCCGAACCCCTGGCGCCGGGGCATGGCTCCCCATTCCCCAGCCTGTCCA
AGAAGGATCTGGACCTCATGCTCCTGGACGACTCACTGCTACCGCTGGCCTCTGATCCACTTCTGTCCAC
CATGTCCCCCGAGGCCTCCAAGGCCAGCAGCCGCCGGAGCAGCTTCAGCATGGAGGAGGGCGATGTGCTG
TGA


Restriction Sites Please inquire     
ACCN NM_001167827
Insert Size 2400 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001167827.1, NP_001161299.1
RefSeq Size 2198 bp
RefSeq ORF 1431 bp
Locus ID 7942
UniProt ID P19484
Protein Families Druggable Genome, Transcription Factors
Gene Summary Transcription factor that specifically recognizes and binds E-box sequences (5'-CANNTG-3'). Efficient DNA-binding requires dimerization with itself or with another MiT/TFE family member such as TFE3 or MITF. In association with TFE3, activates the expression of CD40L in T-cells, thereby playing a role in T-cell-dependent antibody responses in activated CD4(+) T-cells and thymus-dependent humoral immunity. Specifically recognizes and binds the CLEAR-box sequence (5'-GTCACGTGAC-3') present in the regulatory region of many lysosomal genes, leading to activate their expression. It thereby plays a central role in expression of lysosomal genes. Acts as a positive regulator of autophagy by promoting expression of genes involved in autophagy. Specifically recognizes the gamma-E3 box, a subset of E-boxes, present in the heavy-chain immunoglobulin enhancer. Plays a role in the signal transduction processes required for normal vascularization of the placenta. Regulates lysosomal positioning in response to nutrient deprivation by promoting the expression of PIP4P1 (PubMed:29146937).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2, also known as TFEB-A) encodes the longest isoform (2).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...