PPP2R1B (NM_001177563) Human Untagged Clone

CAT#: SC328776

PPP2R1B (untagged)-Human protein phosphatase 2 regulatory subunit A beta (PPP2R1B) transcript variant 5



  "NM_001177563" in other vectors (4)

CNY 7510.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
PPP2R1B mouse monoclonal antibody,clone OTI8B6
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PP2A-Abeta; PR65B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328776 representing NM_001177563.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGGCGCATCAGAGCTCGGGACCGGCCCAGGAGCAGCGGGTGGAGATGGAGATGATTCGCTATAC
CCGATCGCGGTTTTAATCGACGAGCTCCGCAATGAAGACGTGCAGCTCCGACTCAACAGTATTAAGAAG
TTATCAACAATTGCCCTAGCACTTGGAGTAGAAAGGACCCGAAGTGAATTGTTGCCATTTCTTACAGAT
ACAATTTATGATGAAGATGAGGTACTATTAGCTCTTGCTGAGCAGCTGGGAAATTTCACTGGCCTAGTG
GGAGGTCCTGACTTTGCCCACTGTCTGCTGGATTCAGTGCGCCTCCTTGCTGTGGAAGCTTGTGTCAGT
ATTGCCCAGTTATTGTCTCAGGATGACCTTGAGACTTTGGTGATGCCTACACTTCGACAAGCAGCAGAA
GATAAATCTTGGCGCGTTCGCTATATGGTGGCTGACAGATTTTCAGAGCTCCAGAAAGCCATGGGTCCT
AAAATCACCCTAAATGACCTCATCCCCGCCTTTCAGAACCTACTTAAAGACTGTGAAGCTGAAGTCCGG
GCAGCTGCTGCCCACAAAGTAAAAGAACTTGGTGAGAACTTGCCCATTGAAGATAGAGAGACCATAATT
ATGAATCAAATTCTGCCTTATATAAAGGAATTAGTATCCGATACCAATCAACATGTCAAATCGGCTCTA
GCTTCTGTAATTATGGGATTGTCTACTATTTTGGGCAAAGAAAATACCATTGAACATCTTCTACCTCTT
TTCTTAGCTCAGTTAAAGGATGAGTGTCCTGACGTTCGTTTGAATATCATCTCCAATTTGGATTGTGTA
AATGAAGTGATTGGAATCCGTCAGCTCTCTCAGTCTCTCCTTCCTGCCATAGTGGAGCTGGCAGAAGAT
GCCAAATGGAGGGTCCGCCTGGCCATCATTGAGTATATGCCGCTGCTGGCAGGCCAGCTGGGTGTGGAA
TTCTTTGATGAAAAGCTGAATTCTTTATGTATGGCTTGGCTCGTGGACCATGTATACGCCATCCGAGAA
GCTGCCACCAACAACCTCATGAAACTAGTTCAGAAGTTTGGTACAGAGTGGGCCCAAAATACTATTGTT
CCCAAAGTGTTAGTAATGGCAAATGATCCTAATTACTTGCATAGAATGACCACTTTATTCTGCATTAAT
GCACTGTCTGAGGCCTGTGGTCAGGAAATAACTACTAAGCAAATGCTGCCCATCGTATTAAAAATGGCA
GGAGACCAAGTAGCAAATGTTCGCTTCAATGTGGCCAAATCTCTACAAAAGATTGGACCAATTCTAGAT
ACCAATGCTTTACAGGGAGAAGTGAAGCCAGTACTACAGAAGTTAGGTCAAGATGAAGACATGGATGTC
AAATACTTTGCACAGGAAGCTATAAGTGTTCTTGCATTGGCATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001177563
Insert Size 1425 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001177563.1
RefSeq Size 5224 bp
RefSeq ORF 1425 bp
Locus ID 5519
UniProt ID P30154
Protein Families Druggable Genome, Phosphatase, Transcription Factors
Protein Pathways Long-term depression, Oocyte meiosis, TGF-beta signaling pathway, Tight junction, Wnt signaling pathway
MW 52.2 kDa
Gene Summary This gene encodes a constant regulatory subunit of protein phosphatase 2. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The constant regulatory subunit A serves as a scaffolding molecule to coordinate the assembly of the catalytic subunit and a variable regulatory B subunit. This gene encodes a beta isoform of the constant regulatory subunit A. Mutations in this gene have been associated with some lung and colon cancers. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
Transcript Variant: This variant (5) lacks two in-frame exons in the 5' coding region compared to variant 1. The resulting isoform (e) is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...