PC1/3 (PCSK1) (NM_001177876) Human Untagged Clone

CAT#: SC328728

PCSK1 (untagged)-Human proprotein convertase subtilisin/kexin type 1 (PCSK1) transcript variant 3



  "NM_001177876" in other vectors (4)

CNY 7130.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-PCSK1 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BMIQ12; NEC1; PC1; PC3; SPC3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328728 representing NM_001177876.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGGATGGCATTGTGACGGATGCTATTGAGGCCAGTTCAATTGGATTCAATCCTGGACACGTGGAT
ATTTACAGTGCAAGCTGGGGCCCTAATGATGATGGGAAAACTGTGGAGGGGCCTGGCCGGCTAGCCCAG
AAGGCTTTTGAATATGGTGTCAAACAGACGAGCGCTGACCTGCACAATGACTGCACGGAGACGCACACA
GGCACCTCGGCCTCTGCACCTCTGGCTGCTGGCATCTTCGCTCTGGCCCTGGAAGCAAACCCAAATCTC
ACCTGGCGAGATATGCAGCACCTGGTTGTCTGGACCTCTGAGTATGACCCGCTGGCCAATAACCCTGGA
TGGAAAAAGAATGGAGCAGGCTTGATGGTGAATAGTCGATTTGGATTTGGCTTGCTAAATGCCAAAGCT
CTGGTGGATTTAGCTGACCCCAGGACCTGGAGGAGCGTGCCTGAGAAGAAAGAGTGTGTTGTAAAGGAC
AATGACTTTGAGCCCAGAGCCCTGAAAGCTAATGGAGAAGTTATCATTGAAATTCCAACAAGAGCTTGT
GAAGGACAAGAAAATGCTATCAAGTCCCTGGAGCATGTACAATTTGAAGCAACAATTGAATATTCCCGA
AGAGGAGACCTTCATGTCACACTTACTTCTGCTGCTGGAACTAGCACTGTGCTCTTGGCTGAAAGAGAA
CGGGATACATCTCCTAATGGCTTTAAGAATTGGGACTTCATGTCTGTTCACACATGGGGAGAGAACCCT
ATAGGTACTTGGACTTTGAGAATTACAGACATGTCTGGAAGAATTCAAAATGAAGGAAGAATTGTGAAC
TGGAAGCTGATTTTGCACGGGACCTCTTCTCAGCCAGAGCATATGAAGCAGCCTCGTGTGTACACGTCC
TACAACACTGTTCAGAATGACAGAAGAGGGGTGGAGAAGATGGTGGATCCAGGGGAGGAGCAGCCCACA
CAAGAGAACCCTAAGGAGAACACCCTGGTGTCCAAAAGCCCCAGCAGCAGCAGCGTAGGGGGCCGGAGG
GATGAGTTGGAGGAGGGAGCCCCTTCCCAGGCCATGCTGCGACTCCTGCAAAGTGCTTTCAGTAAAAAC
TCACCGCCAAAGCAATCACCAAAGAAGTCCCCAAGTGCAAAGCTCAACATCCCTTATGAAAACTTCTAC
GAAGCCCTGGAAAAGCTGAACAAACCTTCCCAGCTTAAAGACTCTGAAGACAGTCTGTATAATGACTAT
GTTGATGTTTTTTATAACACTAAACCTTACAAGCACAGAGACGACCGGCTGCTTCAAGCTCTGGTGGAC
ATTCTGAATGAGGAAAATTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001177876
Insert Size 1332 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001177876.1
RefSeq Size 4070 bp
RefSeq ORF 1332 bp
Locus ID 5122
Protein Families Druggable Genome, Protease, Secreted Protein
MW 49.3 kDa
Gene Summary This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to subcellular compartments where a second autocatalytic even takes place and the catalytic activity is acquired. The protease is packaged into and activated in dense core secretory granules and expressed in the neuroendocrine system and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It functions in the proteolytic activation of polypeptide hormones and neuropeptides precursors. Mutations in this gene have been associated with susceptibility to obesity and proprotein convertase 1/3 deficiency. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...