Repulsive Guidance Molecule A (RGMA) (NM_001166288) Human Untagged Clone
CAT#: SC328718
RGMA (untagged)-Human RGM domain family member A (RGMA) transcript variant 5
CNY 7220.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | RGM |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001166288, the custom clone sequence may differ by one or more nucleotides
ATGGGTATGGGGAGAGGGGCAGGACGTTCAGCCCTGGGATTCTGGCCGACCCTCGCCTTC CTTCTCTGCAGCTTCCCCGCAGCCACCTCCCCGTGCAAGATCCTCAAGTGCAACTCTGAG TTCTGGAGCGCCACGTCGGGCAGCCACGCCCCAGCCTCAGACGACACCCCCGAGTTCTGT GCAGCCTTGCGCAGCTACGCCCTGTGCACGCGGCGGACGGCCCGCACCTGCCGGGGTGAC CTGGCCTACCACTCGGCCGTCCATGGCATAGAGGACCTCATGAGCCAGCACAACTGCTCC AAGGATGGCCCCACCTCGCAGCCACGCCTGCGCACGCTCCCACCGGCCGGAGACAGCCAG GAGCGCTCGGACAGCCCCGAGATCTGCCATTACGAGAAGAGCTTTCACAAGCACTCGGCC ACCCCCAACTACACGCACTGTGGCCTCTTCGGGGACCCACACCTCAGGACTTTCACCGAC CGCTTCCAGACCTGCAAGGTGCAGGGCGCCTGGCCGCTCATCGACAATAATTACCTGAAC GTGCAGGTCACCAACACGCCTGTGCTGCCCGGCTCAGCGGCCACTGCCACCAGCAAGCTC ACCATCATCTTCAAGAACTTCCAGGAGTGTGTGGACCAGAAGGTGTACCAGGCTGAGATG GACGAGCTCCCGGCCGCCTTCGTGGATGGCTCTAAGAACGGTGGGGACAAGCACGGGGCC AACAGCCTGAAGATCACTGAGAAGGTGTCAGGCCAGCACGTGGAGATCCAGGCCAAGTAC ATCGGCACCACCATCGTGGTGCGCCAGGTGGGCCGCTACCTGACCTTTGCCGTCCGCATG CCAGAGGAAGTGGTCAATGCTGTGGAGGACTGGGACAGCCAGGGTCTCTACCTCTGCCTG CGGGGCTGCCCCCTCAACCAGCAGATCGACTTCCAGGCCTTCCACACCAATGCTGAGGGC ACCGGTGCCCGCAGGCTGGCAGCCGCCAGCCCTGCACCCACAGCCCCCGAGACCTTCCCA TACGAGACAGCCGTGGCCAAGTGCAAGGAGAAGCTGCCGGTGGAGGACCTGTACTACCAG GCCTGCGTCTTCGACCTCCTCACCACGGGCGACGTGAACTTCACACTGGCCGCCTACTAC GCGTTGGAGGATGTCAAGATGCTCCACTCCAACAAAGACAAACTGCACCTGTATGAGAGG ACTCGGGACCTGCCAGGCAGGGCGGCTGCGGGGCTGCCCCTGGCCCCCCGGCCCCTCCTG GGCGCCCTCGTCCCGCTCCTGGCCCTGCTCCCTGTGTTCTGCTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001166288 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001166288.1, NP_001159760.1 |
| RefSeq Size | 3058 bp |
| RefSeq ORF | 1305 bp |
| Locus ID | 56963 |
| UniProt ID | Q96B86 |
| Gene Summary | This gene encodes a member of the repulsive guidance molecule family. The encoded protein is a glycosylphosphatidylinositol-anchored glycoprotein that functions as an axon guidance protein in the developing and adult central nervous system. This protein may also function as a tumor suppressor in some cancers. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009] Transcript Variant: This variant (5) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Variants 2, 3, 5 and 6 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC230080 | RGMA (Myc-DDK-tagged)-Human RGM domain family, member A (RGMA), transcript variant 5 |
CNY 3656.00 |
|
| RC230080L3 | Lenti-ORF clone of RGMA (Myc-DDK-tagged)-Human RGM domain family, member A (RGMA), transcript variant 5 |
CNY 5890.00 |
|
| RC230080L4 | Lenti-ORF clone of RGMA (mGFP-tagged)-Human RGM domain family, member A (RGMA), transcript variant 5 |
CNY 5890.00 |
|
| RG230080 | RGMA (tGFP-tagged) - Human RGM domain family, member A (RGMA), transcript variant 5 |
CNY 4370.00 |
其它Repulsive Guidance Molecule A产品
