CEACAM1 (NM_001184813) Human Untagged Clone
CAT#: SC328707
CEACAM1 (untagged)-Human carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) (CEACAM1) transcript variant 4
CNY 6940.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BGP; BGP1; BGPI |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC328707 representing NM_001184813.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGGCACCTCTCAGCCCCACTTCACAGAGTGCGTGTACCCTGGCAGGGGCTTCTGCTCACAGCCTCA CTTCTAACCTTCTGGAACCCGCCCACCACTGCCCAGCTCACTACTGAATCCATGCCATTCAATGTTGCA GAGGGGAAGGAGGTTCTTCTCCTTGTCCACAATCTGCCCCAGCAACTTTTTGGCTACAGCTGGTACAAA GGGGAAAGAGTGGATGGCAACCGTCAAATTGTAGGATATGCAATAGGAACTCAACAAGCTACCCCAGGG CCCGCAAACAGCGGTCGAGAGACAATATACCCCAATGCATCCCTGCTGATCCAGAACGTCACCCAGAAT GACACAGGATTCTACACCCTACAAGTCATAAAGTCAGATCTTGTGAATGAAGAAGCAACTGGACAGTTC CATGTATACCCGGAGCTGCCCAAGCCCTCCATCTCCAGCAACAACTCCAACCCTGTGGAGGACAAGGAT GCTGTGGCCTTCACCTGTGAACCTGAGACTCAGGACACAACCTACCTGTGGTGGATAAACAATCAGAGC CTCCCGGTCAGTCCCAGGCTGCAGCTGTCCAATGGCAACAGGACCCTCACTCTACTCAGTGTCACAAGG AATGACACAGGACCCTATGAGTGTGAAATACAGAACCCAGTGAGTGCGAACCGCAGTGACCCAGTCACC TTGAATGTCACCTATGGCCCGGACACCCCCACCATTTCCCCTTCAGACACCTATTACCGTCCAGGGGCA AACCTCAGCCTCTCCTGCTATGCAGCCTCTAACCCACCTGCACAGTACTCCTGGCTTATCAATGGAACA TTCCAGCAAAGCACACAAGAGCTCTTTATCCCTAACATCACTGTGAATAATAGTGGATCCTATACCTGC CACGCCAATAACTCAGTCACTGGCTGCAACAGGACCACAGTCAAGACGATCATAGTCACTGATAATGCT CTACCACAAGAAAATGGCCTCTCACCTGGGGCCATTGCTGGCATTGTGATTGGAGTAGTGGCCCTGGTT GCTCTGATAGCAGTAGCCCTGGCATGTTTTCTGCATTTCGGGAAGACCGGCAGGGCAAGCGACCAGCGT GATCTCACAGAGCACAAACCCTCAGTCTCCAACCACACTCAGGACCACTCCAATGACCCACCTAACAAG ATGAATGAAGTTACTTATTCTACCCTGAACTTTGAAGCCCAGCAACCCACACAACCAACTTCAGCCTCC CCATCCCTAACAGCCACAGAAATAATTTATTCAGAAGTAAAAAAGCAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001184813 |
Insert Size | 1293 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001184813.1 |
RefSeq Size | 2670 bp |
RefSeq ORF | 1293 bp |
Locus ID | 634 |
UniProt ID | P13688 |
Protein Families | Druggable Genome, Transmembrane |
MW | 46.9 kDa |
Gene Summary | This gene encodes a member of the carcinoembryonic antigen (CEA) gene family, which belongs to the immunoglobulin superfamily. Two subgroups of the CEA family, the CEA cell adhesion molecules and the pregnancy-specific glycoproteins, are located within a 1.2 Mb cluster on the long arm of chromosome 19. Eleven pseudogenes of the CEA cell adhesion molecule subgroup are also found in the cluster. The encoded protein was originally described in bile ducts of liver as biliary glycoprotein. Subsequently, it was found to be a cell-cell adhesion molecule detected on leukocytes, epithelia, and endothelia. The encoded protein mediates cell adhesion via homophilic as well as heterophilic binding to other proteins of the subgroup. Multiple cellular activities have been attributed to the encoded protein, including roles in the differentiation and arrangement of tissue three-dimensional structure, angiogenesis, apoptosis, tumor suppression, metastasis, and the modulation of innate and adaptive immune responses. Multiple transcript variants encoding different isoforms have been reported, but the full-length nature of all variants has not been defined. [provided by RefSeq, May 2010] Transcript Variant: This variant (4) lacks an alternate, in-frame, exon, compared to variant 1. The resulting protein (isoform 3) is shorter when it was compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC230069 | CEACAM1 (Myc-DDK-tagged)-Human carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) (CEACAM1), transcript variant 4 |
CNY 5488.00 |
|
RC230069L1 | Lenti ORF clone of Human carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) (CEACAM1), transcript variant 4, Myc-DDK-tagged |
CNY 7888.00 |
|
RC230069L2 | Lenti ORF clone of Human carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) (CEACAM1), transcript variant 4, mGFP tagged |
CNY 5890.00 |
|
RC230069L3 | Lenti ORF clone of Human carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) (CEACAM1), transcript variant 4, Myc-DDK-tagged |
CNY 5890.00 |
|
RC230069L4 | Lenti ORF clone of Human carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) (CEACAM1), transcript variant 4, mGFP tagged |
CNY 7888.00 |
|
RG230069 | CEACAM1 (tGFP-tagged) - Human carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) (CEACAM1), transcript variant 4 |
CNY 7088.00 |
其它CEACAM1产品