SLC22A8 (NM_001184736) Human Untagged Clone

CAT#: SC328684

SLC22A8 (untagged)-Human solute carrier family 22 (organic anion transporter) member 8 (SLC22A8) transcript variant 4



  "NM_001184736" in other vectors (4)

CNY 7220.00


货期*
4周

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (4)
Anti-SLC22A8 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms OAT3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001184736, the custom clone sequence may differ by one or more nucleotides
ATGGCCCAGTCTATCTTCATGGCAGGTATACTGATTGGAGGGCTCGTGCTTGGAGACCTG
TCTGACAGGTTTGGCCGCAGGCCCATCCTGACCTGCAGCTACCTGCTGCTGGCAGCCAGC
GGCTCCGGTGCAGCCTTCAGCCCCACCTTCCCCATCTACATGGTCTTCCGCTTCCTGTGT
GGCTTTGGCATCTCAGGCATTACCCTGAGCACCGTCATCTTGAATGTGGAATGGGTGCCT
ACCCGGATGCGGGCCATCATGTCGACAGCACTCGGGTACTGCTACACCTTTGGCCAGTTC
ATTCTGCCCGGCCTGGCCTACGCCATCCCCCAGTGGCGTTGGCTGCAGTTAACTGTGTCC
ATTCCCTTCTTCGTCTTCTTCCTATCATCCTGGTGGACACCAGAGTCCATACGCTGGTTG
GTCTTGTCTGGAAAGTCCTCGAAGGCCCTGAAGATACTCCGGCGGGTGGCTGTCTTCAAT
GGCAAGAAGGAAGAGGGAGAAAGGCTCAGCTTGGAGGAGCTCAAACTCAACCTGCAGAAG
GAGATCTCCTTGGCCAAGGCCAAGTACACCGCAAGTGACCTGTTCCGGATACCCATGCTG
CGCCGCATGACCTTCTGTCTTTCCCTGGCCTGGTTTGCTACCGGTTTTGCCTACTATAGT
TTGGCTATGGGTGTGGAAGAATTTGGAGTCAACCTCTACATCCTCCAGATCATCTTTGGT
GGGGTCGATGTCCCAGCCAAGTTCATCACCATCCTCTCCTTAAGCTACCTGGGCCGGCAT
ACCACTCAGGCCGCTGCCCTGCTCCTGGCAGGAGGGGCCATCTTGGCTCTCACCTTTGTG
CCCTTGGACTTGCAGACCGTGAGGACAGTATTGGCTGTGTTTGGGAAGGGATGCCTATCC
AGCTCCTTCAGCTGCCTCTTCCTCTACACAAGTGAATTATACCCCACAGTCATCAGGCAA
ACAGGTATGGGCGTAAGTAACCTGTGGACCCGCGTGGGAAGCATGGTGTCCCCGCTGGTG
AAAATCACGGGTGAGGTACAGCCCTTCATCCCCAATATCATCTACGGGATCACCGCCCTC
CTCGGGGGCAGTGCTGCCCTCTTCCTGCCTGAGACCCTGAATCAGCCCTTGCCAGAGACT
ATCGAAGACCTGGAAAACTGGTCCCTGCGGGCAAAGAAGCCAAAGCAGGAGCCAGAGGTG
GAAAAGGCCTCCCAGAGGATCCCTCTACAGCCTCACGGACCAGGCCTGGGCTCCAGCTGA
Restriction Sites Please inquire     
ACCN NM_001184736
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001184736.1, NP_001171665.1
RefSeq Size 1839 bp
RefSeq ORF 1260 bp
Locus ID 9376
UniProt ID Q8TCC7
Protein Families Transmembrane
Gene Summary This gene encodes a protein involved in the sodium-independent transport and excretion of organic anions, some of which are potentially toxic. The encoded protein is an integral membrane protein and appears to be localized to the basolateral membrane of the kidney. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, May 2010]
Transcript Variant: This variant (3) lacks an alternate in-frame exon in the 5' coding region and uses a downstream start codon, compared to variant 1. Isoform 3 has a shorter N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...