LMX1B (NM_001174146) Human Untagged Clone

CAT#: SC328654

LMX1B (untagged)-Human LIM homeobox transcription factor 1 beta (LMX1B) transcript variant 3



  "NM_001174146" in other vectors (6)

CNY 6560.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal LMX1B Antibody
    • 100 ug

CNY 5808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FSGS10; LMX1.2; NPS1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328654 representing NM_001174146.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGATATAGCAACAGGTCCCGAGTCGCTGGAGAGGTGCTTCCCTCGCGGGCAGACGGACTGCGCCAAG
ATGTTGGACGGCATCAAGATGGAGGAGCACGCCCTGCGCCCCGGGCCCGCCACTCTGGGGGTGCTGCTG
GGCTCCGACTGCCCGCATCCCGCCGTCTGCGAGGGCTGCCAGCGGCCCATCTCCGACCGCTTCCTGATG
CGAGTCAACGAGTCGTCCTGGCACGAGGAGTGTTTGCAGTGCGCGGCGTGTCAGCAAGCCCTCACCACC
AGCTGCTACTTCCGGGATCGGAAACTGTACTGCAAACAAGACTACCAACAGCTCTTCGCGGCCAAGTGC
AGCGGCTGCATGGAGAAGATCGCCCCCACCGAGTTCGTGATGCGGGCGCTGGAGTGCGTGTACCACCTG
GGCTGCTTCTGCTGCTGCGTGTGTGAACGGCAGCTACGCAAGGGCGACGAATTCGTGCTCAAGGAGGGC
CAGCTGCTGTGCAAGGGTGACTACGAGAAGGAGAAGGACCTGCTCAGCTCCGTGAGCCCCGACGAGTCC
GACTCCGTGAAGAGCGAGGATGAAGATGGGGACATGAAGCCGGCCAAGGGGCAGGGCAGTCAGAGCAAG
GGCAGCGGGGATGACGGGAAGGACCCGCGGAGGCCCAAGCGACCCCGGACCATCCTCACCACGCAGCAG
CGAAGAGCCTTCAAGGCCTCCTTCGAGGTCTCGTCGAAGCCTTGCCGAAAGGTCCGAGAGACACTGGCA
GCTGAGACGGGCCTCAGTGTGCGCGTGGTCCAGGTCTGGTTTCAGAACCAAAGAGCAAAGATGAAGAAG
CTGGCGCGGCGGCACCAGCAGCAGCAGGAGCAGCAGAACTCCCAGCGGCTGGGCCAGGGTGAGCCGGGG
CCGGGGCAGGGCCTGGGCCAGGAGGTCCTGTCCAGCCGCATGGAGGGCATGATGGCTTCCTACACGCCG
CTGGCCCCACCACAGCAGCAGATCGTGGCCATGGAACAGAGCCCCTACGGCAGCAGCGACCCCTTCCAG
CAGGGCCTCACGCCGCCCCAAATGCCAGGGAACGACTCCATCTTCCATGACATCGACAGCGATACCTCC
TTAACCAGCCTCAGCGACTGCTTCCTCGGCTCCTCAGACGTGGGCTCCCTGCAGGCCCGCGTGGGGAAC
CCCATCGACCGGCTCTACTCCATGCAGAGTTCCTACTTCGCCTCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001174146
Insert Size 1221 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001174146.1
RefSeq Size 5816 bp
RefSeq ORF 1221 bp
Locus ID 4010
Protein Families Transcription Factors
MW 45.1 kDa
Gene Summary This gene encodes a member of LIM-homeodomain family of proteins containing two N-terminal zinc-binding LIM domains, 1 homeodomain, and a C-terminal glutamine-rich domain. It functions as a transcription factor, and is essential for the normal development of dorsal limb structures, the glomerular basement membrane, the anterior segment of the eye, and dopaminergic and serotonergic neurons. Mutations in this gene are associated with nail-patella syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Transcript Variant: This variant (3) uses an alternate donor splice site at an internal coding exon compared to variant 1, resulting in a longer isoform (3) containing an additional 11 aa protein segment compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...