TAZ (WWTR1) (NM_001168280) Human Untagged Clone

CAT#: SC328640

WWTR1 (untagged)-Human WW domain containing transcription regulator 1 (WWTR1) transcript variant 3



  "NM_001168280" in other vectors (4)

CNY 6460.00


货期*
6周

规格
    • 10 ug

Product images

推荐一起购买 (4)
WWTR1 (TAZ) mouse monoclonal antibody, clone OTI1H9 (formerly 1H9)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms TAZ
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001168280, the custom clone sequence may differ by one or more nucleotides
ATGAATCCGGCCTCGGCGCCCCCTCCGCTCCCGCCGCCTGGGCAGCAAGTGATCCACGTC
ACGCAGGACCTAGACACAGACCTCGAAGCCCTCTTCAACTCTGTCATGAATCCGAAGCCT
AGCTCGTGGCGGAAGAAGATCCTGCCGGAGTCTTTCTTTAAGGAGCCTGATTCGGGCTCG
CACTCGCGCCAGTCCAGCACCGACTCGTCGGGCGGCCACCCGGGGCCTCGACTGGCTGGG
GGTGCCCAGCATGTCCGCTCGCACTCGTCGCCCGCGTCCCTGCAGCTGGGCACCGGCGCG
GGTGCTGCGGGTAGCCCCGCGCAGCAGCACGCGCACCTCCGCCAGCAGTCCTACGACGTG
ACCGACGAGCTGCCACTGCCCCCGGGCTGGGAGATGACCTTCACGGCCACTGGCCAGAGG
TACTTCCTCAATCACATAGAAAAAATCACCACATGGCAAGACCCTAGGAAGGCGATGAAT
CAGCCTCTGAATCATATGAACCTCCACCCTGCCGTCAGTTCCACACCAGTGCCTCAGAGG
TCCATGGCAGTATCCCAGCCAAATCTCGTGATGAATCACCAACACCAGCAGCAGATGGCC
CCCAGTACCCTGAGCCAGCAGAACCACCCCACTCAGAACCCACCCGCAGGGCTCATGAGT
ATGCCCAATGCGCTGACCACTCAGCAGCAGCAGCAGCAGAAACTGCGGCTTCAGAGAATC
CAGATGGAGAGAGAAAGGATTCGAATGCGCCAAGAGGAGCTCATGAGGCAGGAAGCTGCC
CTCTGTCGACAGCTCCCCATGGAAGCTGAGACTCTTGCCCCAGTTCAGGCTGCTGTCAAC
CCACCCACGATGACCCCAGACATGAGATCCATCACTAATAATAGCTCAGATCCTTTCCTC
AATGGAGGGCCATATCATTCGAGGGAGCAGAGCACTGACAGTGGCCTGGGGTTAGGGTGC
TACAGTGTCCCCACAACTCCGGAGGACTTCCTCAGCAATGTGGATGAGATGGATACAGGA
GAAAACGCAGGACAAACACCCATGAACATCAATCCCCAACAGACCCGTTTCCCTGATTTC
CTTGACTGTCTTCCAGGAACAAACGTTGACTTAGGAACTTTGGAATCTGAAGACCTGATC
CCCCTCTTCAATGATGTAGAGTCTGCTCTGAACAAAAGTGAGCCCTTTCTAACCTGGCTG
TAA
Restriction Sites Please inquire     
ACCN NM_001168280
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001168280.1, NP_001161752.1
RefSeq Size 4999 bp
RefSeq ORF 1203 bp
Locus ID 25937
UniProt ID Q9GZV5
Protein Families Druggable Genome, Transcription Factors
Gene Summary Transcriptional coactivator which acts as a downstream regulatory target in the Hippo signaling pathway that plays a pivotal role in organ size control and tumor suppression by restricting proliferation and promoting apoptosis. The core of this pathway is composed of a kinase cascade wherein STK3/MST2 and STK4/MST1, in complex with its regulatory protein SAV1, phosphorylates and activates LATS1/2 in complex with its regulatory protein MOB1, which in turn phosphorylates and inactivates YAP1 oncoprotein and WWTR1/TAZ. WWTR1 enhances PAX8 and NKX2-1/TTF1-dependent gene activation. Regulates the nuclear accumulation of SMADS and has a key role in coupling them to the transcriptional machinery such as the mediator complex. Regulates embryonic stem-cell self-renewal, promotes cell proliferation and epithelial-mesenchymal transition.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 4. Variants 1 through 4 all encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...