C2CD6 (NM_001168216) Human Untagged Clone
CAT＃: SC328629
ALS2CR11 (untagged)-Human amyotrophic lateral sclerosis 2 (juvenile) chromosome region candidate 11 (ALS2CR11) transcript variant 4
CNY 6370.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ALS2CR11 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001168216, the custom clone sequence may differ by one or more nucleotides
ATGGAGCCACCCCAAGAGACAAATAGGCCTTTCAGCACACTTGATAACCGCAGCGGGCAG GTCCAAGTCCTGTCCGCCACCCCGCTATTGCAGAGGAATCCCTACAGCAGCCCGGATATC ATGCACATTAAAGGGTCGGAGGCTTCTTCGGTCCCTTACGCCCTGAACCAGGGCACGACG GCCCTGCCTAAGAACAAGAACCAGGAGGGCACCGGGCACCGGCTGCTGAACATGCTGAGA AAAACTCTTAAAGAGTCTGATAGTGAAGAACTGGAAATAACACAGGAGACACCAAATTTG GTGCCATTTGGGGATGTGGTTGGCTGCCTGGGCATTCATATAAAGAACTGCAGACATTTT ATGCCTAAGATCAGTTTACAACATTATGCTAATTTATTCATTCGCATCTCTATAAACAAA GCTGTGAAATGTACAAAAATGTGTAGCTTGCTATCCAAAAACGATGAGAAGAACACTGTA ATTAAGTTCGATGAAGTGAAGTATTTTTCTGTACAGGTTCCCAGACGTTATGATGATAAG CGGAATAATATTTTATTGGAACTCATACAATATGACAATAGAGAAAAACGTGCTTTCTTG TTAGGGAGTGTTCAGATACATCTTTATGAGGTAATTCAGAAAGGGTGCTTCATTGAAGAG GTCCAAGTGTTGCATGGAAACATATTTGTCTGCAGGCTGGAGGTGGAATTTATGTTCTCC TATGGAAACTTTGGTTATGGATTTTCACATCAGTTAAAACCTCTTCAGAAAATTACTGAG CCATCCATGTTTATGAATCTTGCACCACCTCCAGAAAGAACAGATCCCGTGACAAAAGTT ATTACACCACAGACAGTAGAATATCCAGCATTCTTATCCCCAGACCTGAATGTTACTGTT GGGACTCCAGCTGTGCAATCCTCCAACCAGCCATCTGTAGTGCGACTTGAAAAACTTCAG CAACAACCCCGGGAAAGGCTGGAAAAGATGAAAAAAGAATATAGAAATCTGAATACATGG ATAGATAAAGCTAACTATTTAGAAAGCATTCTAATGCCAAAATTGGAACATAAGGATTCT GAGGAAACTAATATAGATGAGGCATCTGAAAACACGAAAAGTAATCATCCTGAAGAGGAG CTTGAAAATATTGTAGGAGTAGGTGGCTTTTTCACCAAAAGAATATAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001168216 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001168216.1, NP_001161688.1 |
| RefSeq Size | 1779 bp |
| RefSeq ORF | 1188 bp |
| Locus ID | 151254 |
| UniProt ID | Q53TS8 |
| Gene Summary | An autosomal recessive form of juvenile amyotrophic lateral sclerosis was originally mapped to a region of chromosome 2 that includes this gene. The encoded protein contains a calcium-dependent membrane targeting C2 domain. This domain is often found in proteins that are involved in membrane trafficking and signal transduction. [provided by RefSeq, Jun 2016] Transcript Variant: This variant (4) lacks several alternate exons in the 3' coding region, compared to variant 1, one of which results in a frameshift. The resulting protein (isoform 4) has a shorter and distinct C-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229991 | ALS2CR11 (Myc-DDK-tagged)-Human amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11 (ALS2CR11), transcript variant 4 |
CNY 3656.00 |
|
| RC229991L3 | Lenti-ORF clone of ALS2CR11 (Myc-DDK-tagged)-Human amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11 (ALS2CR11), transcript variant 4 |
CNY 5890.00 |
|
| RC229991L4 | Lenti-ORF clone of ALS2CR11 (mGFP-tagged)-Human amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11 (ALS2CR11), transcript variant 4 |
CNY 5890.00 |
|
| RG229991 | ALS2CR11 (tGFP-tagged) - Human amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11 (ALS2CR11), transcript variant 4 |
CNY 4370.00 |
