PHKG2 (NM_001172432) Human Untagged Clone
CAT#: SC328597
PHKG2 (untagged)-Human phosphorylase kinase gamma 2 (testis) (PHKG2) transcript variant 2
CNY 6080.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GSD9C |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC328597 representing NM_001172432.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACGCTGGACGTGGGGCCGGAGGATGAGCTGCCCGACTGGGCCGCCGCCAAAGAGTTTTACCAGAAG TACGACCCTAAGGACGTCATCGGCAGAGGAGTGAGCTCTGTGGTCCGCCGTTGTGTTCATCGAGCTACT GGCCACGAGTTTGCGGTGAAGATTATGGAAGTGACAGCTGAGCGGCTGAGTCCTGAGCAGCTGGAGGAG GTGCGGGAAGCCACACGGCGAGAGACACACATCCTTCGCCAGGTCGCCGGCCACCCCCACATCATCACC CTCATCGATTCCTACGAGTCTTCTAGCTTCATGTTCCTGGTGTTTGACCTGATGCGGAAGGGAGAGCTG TTTGACTATCTCACAGAGAAGGTGGCCCTCTCTGAAAAGGAAACCAGGTCCATCATGCGGTCTCTGCTG GAAGCAGTGAGCTTTCTCCATGCCAACAACATTGTGCATCGAGATCTGAAGCCCGAGAATATTCTCCTA GATGACAATATGCAGATCCGACTTTCAGATTTCGGGTTCTCCTGCCACTTGGAACCTGGCGAGAAGCTT CGAGAGTTGTGTGGGACCCCAGGGTATCTAGCGCCAGAGATCCTTAAATGCTCCATGGATGAAACCCAC CCAGGCTATGGCAAGGAGGTCGACCTCTGGGCCTGTGGGGTGATCTTGTTCACACTCCTGGCTGGCTCG CCACCCTTCTGGCACCGGCGGCAGATCCTGATGTTACGCATGATCATGGAGGGCCAGTACCAGTTCAGT TCCCCCGAGTGGGATGACCGTTCCAGCACTGTCAAAGACCTGATCTCCAGGCTGCTGCAGGTGGATCCT GAGGCACGCCTGACAGCTGAGCAGGCCCTACAGCACCCCTTCTTTGAGCGTTGTGAAGGCAGCCAACCC TGGAACCTCACCCCCCGCCAGCGGTTCCGGGTGGCAGTGTGGACAGTGCTGGCTGCTGGACGAGTGGCC CTAAGCACCCATCGTGTACGGCCACTGACCAAGAATGCACTGTTGAGGGACCCTTATGCGCTGCGGTCA GTGCGGCACCTCATCGACAACTGTGCCTTCCGGCTCTACGGGCACTGGATAAGGAAGCAGTGGATTGGA AAGCTGATGGCTTGTGTATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001172432 |
Insert Size | 1125 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001172432.1 |
RefSeq Size | 2367 bp |
RefSeq ORF | 1125 bp |
Locus ID | 5261 |
UniProt ID | P15735 |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | Calcium signaling pathway, Insulin signaling pathway |
MW | 43.2 kDa |
Gene Summary | Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The beta subunit is the same in both the muscle and hepatic isoforms, and encoded by one gene. The gamma subunit also includes the skeletal muscle and hepatic isoforms, and the hepatic isoform is encoded by this gene. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9C, also known as autosomal liver glycogenosis. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010] Transcript Variant: This variant (2) lacks an internal segment in the 3' region, as compared to variant 1. The resulting isoform (2) is shorter and has a different C-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229959 | PHKG2 (Myc-DDK-tagged)-Human phosphorylase kinase, gamma 2 (testis) (PHKG2), transcript variant 2 |
CNY 3656.00 |
|
RC229959L3 | Lenti ORF clone of Human phosphorylase kinase, gamma 2 (testis) (PHKG2), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC229959L4 | Lenti ORF clone of Human phosphorylase kinase, gamma 2 (testis) (PHKG2), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG229959 | PHKG2 (tGFP-tagged) - Human phosphorylase kinase, gamma 2 (testis) (PHKG2), transcript variant 2 |
CNY 4370.00 |