PGM1 (NM_001172819) Human Untagged Clone
CAT#: SC328587
PGM1 (untagged)-Human phosphoglucomutase 1 (PGM1) transcript variant 3
CNY 7220.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CDG1T; GSD14 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001172819, the custom clone sequence may differ by one or more nucleotides
ATGCTGAGAAGCATCTTTGATTTCAGTGCACTGAAAGAACTACTTTCTGGGCCAAACCGA CTGAAGATCCGTATTGATGCTATGCATGGAGTTGTGGGACCGTATGTAAAGAAGATCCTC TGTGAAGAACTCGGTGCCCCTGCGAACTCGGCAGTTAACTGCGTTCCTCTGGAGGACTTT GGAGGCCACCACCCTGACCCCAACCTCACCTATGCAGCTGACCTGGTGGAGACCATGAAG TCAGGAGAGCATGATTTTGGGGCTGCCTTTGATGGAGATGGGGATCGAAACATGATTCTG GGCAAGCATGGGTTCTTTGTGAACCCTTCAGACTCTGTGGCTGTCATTGCTGCCAACATC TTCAGCATTCCGTATTTCCAGCAGACTGGGGTCCGCGGCTTTGCACGGAGCATGCCCACG AGTGGTGCTCTGGACCGGGTGGCTAGTGCTACAAAGATTGCTTTGTATGAGACCCCAACT GGCTGGAAGTTTTTTGGGAATTTGATGGACGCGAGCAAACTGTCCCTTTGTGGGGAGGAG AGCTTCGGGACCGGTTCTGACCACATCCGTGAGAAAGATGGACTGTGGGCTGTCCTTGCC TGGCTCTCCATCCTAGCCACCCGCAAGCAGAGTGTGGAGGACATTCTCAAAGATCATTGG CAAAAGTATGGCCGGAATTTCTTCACCAGGTATGATTACGAGGAGGTGGAAGCTGAGGGC GCAAACAAAATGATGAAGGACTTGGAGGCCCTGATGTTTGATCGCTCCTTTGTGGGGAAG CAGTTCTCAGCAAATGACAAAGTTTACACTGTGGAGAAGGCCGATAACTTTGAATACAGC GACCCAGTGGATGGAAGCATTTCAAGAAATCAGGGCTTGCGCCTCATTTTCACAGATGGT TCTCGAATCGTCTTCCGACTGAGCGGCACTGGGAGTGCCGGGGCCACCATTCGGCTGTAC ATCGATAGCTATGAGAAGGACGTTGCCAAGATTAACCAGGACCCCCAGGTCATGTTGGCC CCCCTTATTTCCATTGCTCTGAAAGTGTCCCAGCTGCAGGAGAGGACGGGACGCACTGCA CCCACTGTCATCACCTAA |
Restriction Sites | Please inquire |
ACCN | NM_001172819 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001172819.1, NP_001166290.1 |
RefSeq Size | 2364 bp |
RefSeq ORF | 1098 bp |
Locus ID | 5236 |
UniProt ID | P36871 |
Protein Pathways | Amino sugar and nucleotide sugar metabolism, Galactose metabolism, Glycolysis / Gluconeogenesis, Metabolic pathways, Pentose phosphate pathway, Starch and sucrose metabolism |
Gene Summary | The protein encoded by this gene is an isozyme of phosphoglucomutase (PGM) and belongs to the phosphohexose mutase family. There are several PGM isozymes, which are encoded by different genes and catalyze the transfer of phosphate between the 1 and 6 positions of glucose. In most cell types, this PGM isozyme is predominant, representing about 90% of total PGM activity. In red cells, PGM2 is a major isozyme. This gene is highly polymorphic. Mutations in this gene cause glycogen storage disease type 14. Alternativley spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Mar 2010] Transcript Variant: This variant (3) has an alternate 5' exon, which results in a downstream AUG start codon, as compared to variant 1. The resulting isoform (3) is shorter at the N-terminus, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229949 | PGM1 (Myc-DDK-tagged)-Human phosphoglucomutase 1 (PGM1), transcript variant 3 |
CNY 5610.00 |
|
RC229949L3 | Lenti-ORF clone of PGM1 (Myc-DDK-tagged)-Human phosphoglucomutase 1 (PGM1), transcript variant 3 |
CNY 7510.00 |
|
RC229949L4 | Lenti-ORF clone of PGM1 (mGFP-tagged)-Human phosphoglucomutase 1 (PGM1), transcript variant 3 |
CNY 7510.00 |
|
RG229949 | PGM1 (tGFP-tagged) - Human phosphoglucomutase 1 (PGM1), transcript variant 3 |
CNY 6180.00 |