RNF32 (NM_001184997) Human Untagged Clone
CAT＃: SC328579
RNF32 (untagged)-Human ring finger protein 32 (RNF32) transcript variant 2
CNY 5800.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | FKSG33; HSD15; LMBR2 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001184997, the custom clone sequence may differ by one or more nucleotides
ATGTTAAAAAATAAGGGTCACTCATCTAAGAAAGATAACTTGGCAGTCAATGCAGTTGCT TTACAAGATCACATTTTACATGATCTTCAACTTCGAAATCTTTCAGTTGCAGATCATTCT AAGACACAAGTACAAAAGAAAGAGAACAAATCTCTAAAAAGAGATACAAAGGCAATAATA GATACTGGACTTAAAAAAACTACACAGTGCCCCAAACTAGAAGACTCAGAAAAAGAATAT GTTCTTGATCCCAAACCGCCGCCGTTGACTTTGGCACAGAAGTTGGGCCTCATTGGGCCT CCACCACCTCCACTGTCATCAGATGAATGGGAGAAGGTGAAACAGCGCTCTCTCCTGCAA GGGGACTCCGTGCAACCATGCCCCATCTGTAAAGAAGAATTCGAGCTTCGTCCTCAGGTG CTGCTTTCATGCTCCCATGTGTTCCACAAAGCATGTCTTCAGGCTTTTGAAAAGTTCACA AATAAGAAAACCTGTCCTCTCTGTAGAAAGAACCAGTATCAAACCCGAGTGATACACGAT GGGGCCCGCCTGTTCAGAATCAAGTGTGTGACCAGAATCCAAGCCTACTGGAGAGGATGT GTTGTTAGAAAGTGGTACAGAAACCTGAGGAAAACAGTACCTCCCACAGATGCCAAGTTA AGAAAAAAATTCTTTGAAAAAAAGTTCACAGAAATCAGCCACCGCATCCTGTGCTCATAC AACACCAACATTGAAGAGCTCTTTGCAGAAATCGATCAGTGCTTGGCCATAAATCGAAGT GTTCTTCAGCAGTTGGAAGAAAAATGTGGCCATGAGATCACAGAAGAGGAATGGGAGAAA ATCCAAGTGCAGGCTCTGCGCCGGGAGACCCACGAGTGCTCCATCTGCCTGGCCCCTCTC TCCGCTGCTGGCGGTCAGCGCGTGGGTGCAGGCAGGCGTTCCAGAGAGATGGCCCTCCTG TCCTGCTCACATGTGTTCCACCATGCGTGTCTGCTGGCACTAGAGGAGTTCTCCGTGGGA GACAGGCCTCCTTTCCATGCCTGTCCTCTCTGCCGCTCCTGCTACCAGAAGAAGATTCTT GAATGTTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001184997 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001184997.1, NP_001171926.1 |
| RefSeq Size | 1752 bp |
| RefSeq ORF | 1089 bp |
| Locus ID | 140545 |
| UniProt ID | Q9H0A6 |
| Protein Families | Druggable Genome |
| Gene Summary | The protein encoded by this gene contains two RING ring finger motifs. RING finger motifs are present in a variety of functionally distinct proteins and are known to be involved in protein-DNA or protein-protein interactions. This gene was found to be expressed during spermatogenesis, most likely in spermatocytes and/or in spermatids. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 all encode isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229941 | RNF32 (Myc-DDK-tagged)-Human ring finger protein 32 (RNF32), transcript variant 2 |
CNY 3656.00 |
|
| RC229941L3 | Lenti-ORF clone of RNF32 (Myc-DDK-tagged)-Human ring finger protein 32 (RNF32), transcript variant 2 |
CNY 5890.00 |
|
| RC229941L4 | Lenti-ORF clone of RNF32 (mGFP-tagged)-Human ring finger protein 32 (RNF32), transcript variant 2 |
CNY 5890.00 |
|
| RG229941 | RNF32 (tGFP-tagged) - Human ring finger protein 32 (RNF32), transcript variant 2 |
CNY 4370.00 |
